Revision as of 02:42, 28 October 2020

pHimarEm1

This is the sequence for the backbone of one of the main plasmids that is used in order to genetically manipulate several categories of bacteria, including Flavobacteriia[1].

Description

This rather big plasmid has long been used in order to integrate genetic material into the genome of Flavobacteria[2]. While it is 6 kb long, not all of them are functional. The main points of interest of this plasmid are its gene encoding a protein that confers resistance to Kanamycin and Neomycin (KanR from Tn4351), Aminoglycosidase phosphotransferase and the gene encoding a protein that confers resistance to Erythromycin (ErmF from Bacteroides fragilis), rRNA adenine N-6-methyltransferase.

The interesting fact about this plasmid is that the KanR gene is expressed in most E. coli strains, whereas ErmF is not[3]. In stark contrast, the ErmF gene is expressed in other bacteria, such as Flavobacteriia, making pHimarEm1 a prime candidate for conjugation based genetic transfer, especially for bacteria where transformation is not as efficient as conjugation. The precise reason that ErmF is not expressed in most E. coli is not known, to our knowledge.

Furthermore, the plasmid carries the Mariner transposase[4] and the corresponding inverted repeats (IRs), which are: ACAGGTTGGCTGATAAGTCCCCGGTC and AGACCGGGGACTTATCAGCCAACCTG.

In order to make transposition inducible, the transposase is placed under the control of an inducible lac promoter using the regular lac operon. This means that transposition can be initiated at will by introducing IPTG to the growth medium.

Finally, the R6K γ ori ensures that the plasmid can be stably replicated when not integrated in the bacterial chromosome[5].

Optimization & Protein Analysis

Proteins encoded by pHimar were optimized for expression in Flavobacteriia, utilizing the Kazusa codon database[6].

Furthermore, the plasmid was checked for the existence of other ORFs that may be translated and would place unnecessary metabolic burden on our strain. After a thorough search, where each putative ORF was searched against the Pfam[7], TIGRFAM[8] Gene3D[9], Superfamily[10], PIRSF[11], TreeFam[12] using HMMER[13] and the only putative ORF that matched any known motif was the remainder of another transposase, as revealed by BLAST[14].

Furthermore, for each ORF, the 100 immediate bases upstream of the start codon were queried for the existence of promoter sequences using 5 bacterial promoter sequence prediction services: CNNProm[15], iPro70FMWin[16], 70ProPred[17] iPromoter-2L[18], based on a recent benchmarking study[19]. While some upstream sequences were identified as potential promoter sequences for σ70 (Flavobacterium johnsoniae's σ70 has about 30% homology with E. coli's), none of the ORFs that encoded a long enough sequence (over 100 aminoacids) and had a motif match (in any of the aforementioned 5 databases), had a promoter.

We stress here that these computational results are to be taken with a grain of salt, as most promoter identification services are inaccurate even for model bacteria, such as E. coli or Bacillus subtilis, so they are expected to be more inaccurate for less researched bacteria, such as Flavobacterium johnsoniae.

Plasmid map

Figure 1: pHimarEm1 plasmid map

Athens 2020

The current part is utilised by the iGEM Athens 2020 team during the project MORPHÆ. In this project, Flavobacteria were used to produce a non-cellular structurally coloured biomaterial which would require the secretion of a biomolecule that Flavobacteria do not normally secrete. Our hypothesis is that the formed matrix will have a structure similar to that of the biofilm and thus, it will provide the material with macroscopically the same colouration properties as the biofilm.

In order to transfer the desired genes into the genome of Flavobacterium johnsoniae, our chassis of choice, we utilise conjugation of the strain UW101 with E. coli S17-1. Once conjugation is complete, transposition will be induced, in order to integrate the genes of interest into F. johnsoniae's chromosome, after which expression will occur.

Source of this part

The nucleotide sequences of the pHimarEm1 plasmid was obtained upon communication with Dr. Mark J. McBridge, as well as Dr. Colin Ingham. Published maps of the plasmid exist, but this is the first time the complete sequence is deposited to our knowledge.

Useful Links:

NCBI taxonomy:

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=28448&lvl=3&lin=f&keep=1&srchmode=1&unlock

Codon optimisation bank:

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=986&lvl=0

http://genomes.urv.es/OPTIMIZER/?fbclid=IwAR0ALbP_C8UVY4itvYdNX8b5KYYUM5ulQojz8UJAK6Zj5llobNNxE-jYmXQ

Codon optimization table:

https://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=376686&fbclid=IwAR0gwwrIarZsiYhWvHPc2BKy-iB_2OM-DPB5I2HYJZwBNiasmlLXWK87PwM

REFERENCES

McBride, M. J., & Baker, S. A. (1996). Development of techniques to geneticallymanipulate members of the genera cytophaga, flavobacterium, flexibac-ter, and sporocytophaga.Applied and environmental microbiology,62(8),3017–3022. doi:10.1128/aem.62.8.3017-3022.1996

Braun, T. F., Khubbar, M. K., Saffarini, D. A., & McBride, M. J. (2005).Flavobacterium johnsoniae gliding motility genes identified by marinermutagenesis.Journal of Bacteriology,187(20), 6943–6952. doi:10.1128/jb.187.20.6943-6952.2005

Chen, S., Blom, J., Loch, T. P., Faisal, M., & Walker, E. D. (2017). The emerg-ing fish pathogen flavobacterium spartansii isolated from chinook salmon:Comparative genome analysis and molecular manipulation.Frontiers inMicrobiology,8. doi:10.3389/fmicb.2017.02339

Trubitsyna, M., Michlewski, G., Finnegan, D. J., Elfick, A., Rosser, S. J., Richard-son, J. M., & French, C. E. (2017). Use of mariner transposases for one-stepdelivery and integration of DNA in prokaryotes and eukaryotes by trans-fection.Nucleic Acids Research,45(10), e89–e89. doi:10.1093/nar/gkx113

Rakowski, S. A., & Filutowicz, M. (2013). Plasmid r6k replication control.Plas-mid,69(3), 231–242. doi:10.1016/j.plasmid.2013.02.003

Nakamura, Y. (2000). Codon usage tabulated from international DNA sequencedatabases: Status for the year 2000.Nucleic Acids Research,28(1), 292–292. doi:10.1093/nar/28.1.292

El-Gebali, S., Mistry, J., Bateman, A., Eddy, S. R., Luciani, A., Potter, S. C., . . .Finn, R. D. (2018). The pfam protein families database in 2019.NucleicAcids Research,47(D1), D427–D432. doi:10.1093/nar/gky995

Haft, D. H. (2003). The TIGRFAMs database of protein families.Nucleic AcidsResearch,31(1), 371–373. doi:10.1093/nar/gkg128
Lees, J., Yeats, C., Perkins, J., Sillitoe, I., Rentzsch, R., Dessailly, B. H., &Orengo, C. (2011). Gene3d: A domain-based resource for comparative ge-nomics, functional annotation and protein network analysis.Nucleic AcidsResearch,40(D1), D465–D471. doi:10.1093/nar/gkr1181

Pandurangan, A. P., Stahlhacke, J., Oates, M. E., Smithers, B., & Gough, J.(2018). The SUPERFAMILY 2.0 database: A significant proteome updateand a new webserver.Nucleic Acids Research,47(D1), D490–D494. doi:10.1093/nar/gky1130

Wu, C. H. (2004). PIRSF: Family classification system at the protein informa-tion resource.Nucleic Acids Research,32(90001), 112D–114. doi:10.1093/nar/gkh097

Schreiber, F., Patricio, M., Muffato, M., Pignatelli, M., & Bateman, A. (2013).TreeFam v9: A new website, more species and orthology-on-the-fly.Nu-cleic Acids Research,42(D1), D922–D925. doi:10.1093/nar/gkt1055

Finn, R. D., Clements, J., & Eddy, S. R. (2011). HMMER web server: Interactivesequence similarity searching.Nucleic Acids Research,39(suppl), W29–W37. doi:10.1093/nar/gkr3672

Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K.,& Madden, T. L. (2009). BLAST: Architecture and applications.BMCBioinformatics,10(1), 421. doi:10.1186/1471-2105-10-421 </br>
Solovyev, V., & Umarov, R. (2016). Prediction of prokaryotic and eukaryoticpromoters using convolutional deep learning neural networks. arXiv: 1610.00121[q-bio.GN]

Rahman, M. S., Aktar, U., Jani, M. R., & Shatabda, S. (2018). Ipro70-fmwin:Identifying sigma70 promoters using multiple windowing and minimal fea-tures.Molecular Genetics and Genomics, 1–16.He, W., Jia, C., Duan, Y., & Zou, Q. (2018).

70propred: A predictor for dis-covering sigma70 promoters based on combining multiple features.BMCSystems Biology,12(S4). doi:10.1186/s12918-018-0570-1

Liu, B., Yang, F., Huang, D.-S., & Chou, K.-C. (2017). iPromoter-2l: A two-layer predictor for identifying promoters and their types by multi-window-based PseKNC.Bioinformatics,34(1), 33–40. doi:10.1093/bioinformatics/btx579

Cassiano, M. H. A., & Silva-Rocha, R. (2020). Benchmarking bacterial promoterprediction tools: Potentialities and limitations.mSystems,5(4). doi:10 .1128/msystems.00439-20