Difference between revisions of "Part:BBa K3338004"

(→‎Characterization)
(→‎Characterization)
Line 63: Line 63:
 
To assess the stoichiometry of simultaneous expression of both fluorescent proteins in the case of IRES, transfection of HeLa cells with the plasmid was performed by lipofection (ViaFect transfection reagent) or electroporation and fluorescence microscopy was used for subsequent analysis. The fluorescence intensities of mCherry and EGFP can be used to assess the expression of both proteins and are roughly comparable among themselves. The results indicate that the induction of translation carried out by IRES is very small when compared to the normal induction mechanism involving the 5’-cap. This is manifested by a strong expression of EGFP, whose translation is initiated by the normal mechanism, and a very weak expression of mCherry, which is translated under control of the IRES (see figure 2). In cells that exhibit only weak expression of EGFP, mCherry could not be detected anymore.
 
To assess the stoichiometry of simultaneous expression of both fluorescent proteins in the case of IRES, transfection of HeLa cells with the plasmid was performed by lipofection (ViaFect transfection reagent) or electroporation and fluorescence microscopy was used for subsequent analysis. The fluorescence intensities of mCherry and EGFP can be used to assess the expression of both proteins and are roughly comparable among themselves. The results indicate that the induction of translation carried out by IRES is very small when compared to the normal induction mechanism involving the 5’-cap. This is manifested by a strong expression of EGFP, whose translation is initiated by the normal mechanism, and a very weak expression of mCherry, which is translated under control of the IRES (see figure 2). In cells that exhibit only weak expression of EGFP, mCherry could not be detected anymore.
  
−
T--Hannover--results_IRES_vs_P2A: Figure 2: Representative microscopy images of HeLa cells transfected with CMV-eGFP-IRES-mCherry (top) or CMV-eGFP-P2A-mCherry (bottom). Images of three channels are shown: green fluorescence (left), red fluorescence (middle) and brightfield (right). Scale bar: 100 µm.
+
 
 +
 
 +
<html>
 +
<img src="https://static.igem.org/mediawiki/parts/a/ad/T--Hannover--results_IRES_vs_P2A.png" class="center" style="width: 90%; height: 90%">
 +
</p>
 +
</html>
 +
Figure 2: Representative microscopy images of HeLa cells transfected with CMV-eGFP-IRES-mCherry (top) or CMV-eGFP-P2A-mCherry (bottom). Images of three channels are shown: green fluorescence (left), red fluorescence (middle) and brightfield (right). Scale bar: 100 µm.
 +
 
 +
 
  
 
During our project we also tested the expression efficiencies using a P2A peptide (<html><a href="https://parts.igem.org/Part:BBa_K3338003">BBa_K3338003</a></html>) as a separator. To compare the stoichiometry of simultaneous expression of both fluorescent proteins, we also designed a vector exhibiting P2A instead of IRES as a connecter between EGFP and mCherry (see figure 1A). The results for P2A clearly show that the EGFP expression is highly comparable with the mCherry expression and that the expression of mCherry is much higher than in the case of the IRES construct. But it is of note that the EGFP-expression is much higher using the IRES construct instead of the P2A construct. This is because in the IRES-construct the translation of EGFP is induced by the normal translation machinery and only the translation of mCherry is regulated through the IRES. When using P2A, both proteins are read from the same ribisome, which could reduce the total amount of protein produced.
 
During our project we also tested the expression efficiencies using a P2A peptide (<html><a href="https://parts.igem.org/Part:BBa_K3338003">BBa_K3338003</a></html>) as a separator. To compare the stoichiometry of simultaneous expression of both fluorescent proteins, we also designed a vector exhibiting P2A instead of IRES as a connecter between EGFP and mCherry (see figure 1A). The results for P2A clearly show that the EGFP expression is highly comparable with the mCherry expression and that the expression of mCherry is much higher than in the case of the IRES construct. But it is of note that the EGFP-expression is much higher using the IRES construct instead of the P2A construct. This is because in the IRES-construct the translation of EGFP is induced by the normal translation machinery and only the translation of mCherry is regulated through the IRES. When using P2A, both proteins are read from the same ribisome, which could reduce the total amount of protein produced.

Revision as of 23:18, 26 October 2020


Internal ribosome entry site (IRES) for use in eukaryotic cells

Usage and Biology

The internal ribosome entry site (IRES) as descripted here was originally derived from the Hepatitis C virus (HCV) sequence. It is located within the 5’UTRs of the HCV genome and forms a complex 3D secondary structure making it capable of binding 40s ribosomal subunits and thus induces translation of the following gene (Beales et al. 2001, Lytle et al. 2002). This mechanism is independent of a 5’ cap structure and many of the initiation factors associated with it (Beales et al. 2001). Such structures are found in many viral genomes but only a small number of eukaryotic mRNAs where they are used to form polycistronic mRNAs (Beales et al. 2001, Karginov et al. 2017). In synthetic biology it is used to build synthetic polycistronic mRNAs for expression of multiple genes under control of one promoter (for example Chen et al. 2009).

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Characterization

To assess the efficiency of the IRES, we cloned the IRES as a connector between EGFP and mCherry. Therefore, we amplified mCherry from the Addgene plasmid #45350 and IRES from the Addgene plasmid #72893 using primers with 20 bp overhangs suitable for NEBuilder® HiFi DNA Assembly cloning (for primers see table 1). The vector backbone was generated by linearizing the pEGFP-C2 vector (BBa_K3338020) with EcoRI and BamHI. The final construct was sequentially verified. The vector map of the plasmid is shown in figure 1B.


HTML Table Caption Table1: Primers used to design the fragments.

Primer name Sequence
IRES_fw TACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGCTTAGTAGGcccctctccctcccccccccctaac
IRES_rv tcctcgcccttgctcaccatttatcatcgtgtttttcaaaggaaaaccacg
mCherry_fw for IRES tttgaaaaacacgatgataaatggtgagcaagggcgag
mCherry_rv for IRES TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGcttgtacagctcgtccatgcc


Figure 1: Vector maps of EGFP-P2A-mCherry (A) and EGFP-IRES-mCherry (B) under control of the CMV-enhancer/promoter.


To assess the stoichiometry of simultaneous expression of both fluorescent proteins in the case of IRES, transfection of HeLa cells with the plasmid was performed by lipofection (ViaFect transfection reagent) or electroporation and fluorescence microscopy was used for subsequent analysis. The fluorescence intensities of mCherry and EGFP can be used to assess the expression of both proteins and are roughly comparable among themselves. The results indicate that the induction of translation carried out by IRES is very small when compared to the normal induction mechanism involving the 5’-cap. This is manifested by a strong expression of EGFP, whose translation is initiated by the normal mechanism, and a very weak expression of mCherry, which is translated under control of the IRES (see figure 2). In cells that exhibit only weak expression of EGFP, mCherry could not be detected anymore.


Figure 2: Representative microscopy images of HeLa cells transfected with CMV-eGFP-IRES-mCherry (top) or CMV-eGFP-P2A-mCherry (bottom). Images of three channels are shown: green fluorescence (left), red fluorescence (middle) and brightfield (right). Scale bar: 100 µm.


During our project we also tested the expression efficiencies using a P2A peptide (BBa_K3338003) as a separator. To compare the stoichiometry of simultaneous expression of both fluorescent proteins, we also designed a vector exhibiting P2A instead of IRES as a connecter between EGFP and mCherry (see figure 1A). The results for P2A clearly show that the EGFP expression is highly comparable with the mCherry expression and that the expression of mCherry is much higher than in the case of the IRES construct. But it is of note that the EGFP-expression is much higher using the IRES construct instead of the P2A construct. This is because in the IRES-construct the translation of EGFP is induced by the normal translation machinery and only the translation of mCherry is regulated through the IRES. When using P2A, both proteins are read from the same ribisome, which could reduce the total amount of protein produced.

Summary

In summing up, the IRES can be used to build multicistronic vectors. But depending on the properties of the connector needed for a special application, the use of P2A could be beneficial.

References

Beales, L. P., Rowlands, D. J., & Holzenburg, A. (2001). The internal ribosome entry site (IRES) of hepatitis C virus visualized by electron microscopy. RNA (New York, N.Y.), 7(5), 661–670.

Chen, W. S., Chang, Y. C., Chen, Y. J., Chen, Y. J., Teng, C. Y., Wang, C. H., & Wu, T. Y. (2009). Development of a prokaryotic-like polycistronic baculovirus expression vector by the linkage of two internal ribosome entry sites. Journal of virological methods, 159(2), 152–159.

Lytle, J. R., Wu, L., & Robertson, H. D. (2002). Domains on the hepatitis C virus internal ribosome entry site for 40s subunit binding. RNA (New York, N.Y.), 8(8), 1045–1055.

Karginov, T. A., Pastor, D., Semler, B. L., & Gomez, C. M. (2017). Mammalian Polycistronic mRNAs and Disease. Trends in genetics: TIG, 33(2), 129–142.

Szymczak-Workman, A. L., Vignali, K. M., & Vignali, D. A. (2012). Design and construction of 2A peptide-linked multicistronic vectors. Cold Spring Harbor protocols, 2012(2), 199–204.