Difference between revisions of "Part:BBa K1442039"
| Line 97: | Line 97: | ||
<html> | <html> | ||
| − | <img src="https://static.igem.org/mediawiki/parts/c/ca/T--Hannover--parts_P2A-IRES.png" class="center | + | <img src="https://static.igem.org/mediawiki/parts/c/ca/T--Hannover--parts_P2A-IRES.png" class="center"> |
| − | + | ||
</html> | </html> | ||
Figure 1: Vector maps of EGFP-P2A-mCherry (A) and EGFP-IRES-mCherry (B) under control of the CMV-enhancer/promoter. | Figure 1: Vector maps of EGFP-P2A-mCherry (A) and EGFP-IRES-mCherry (B) under control of the CMV-enhancer/promoter. | ||
| Line 109: | Line 108: | ||
<html> | <html> | ||
| − | <img src="https://static.igem.org/mediawiki/parts/a/ad/T--Hannover--results_IRES_vs_P2A.png" class="center"> | + | <img src="https://static.igem.org/mediawiki/parts/a/ad/T--Hannover--results_IRES_vs_P2A.png" class="center" style="width: 95%; height: 95%"> |
| + | </p> | ||
</html> | </html> | ||
Figure 2: Representative microscopy images of HeLa cells transfected with CMV-eGFP-IRES-mCherry (top) or CMV-eGFP-P2A-mCherry (bottom). Images of three channels are shown: green fluorescence (left), red fluorescence (middle) and brightfield (right). Scale bar: 100 µm. | Figure 2: Representative microscopy images of HeLa cells transfected with CMV-eGFP-IRES-mCherry (top) or CMV-eGFP-P2A-mCherry (bottom). Images of three channels are shown: green fluorescence (left), red fluorescence (middle) and brightfield (right). Scale bar: 100 µm. | ||
Revision as of 20:32, 26 October 2020
P2A self-cleaving peptide sequence
The self-cleaving 2A peptide (18-22 amino acids) is a virally derived coding region that has been utilised by viruses to self-cleave during translation and is likely to have arisen to overcome traditional IRES sequences due to its much smaller coding length and allows for a smaller viral genome [1].
Of the available 2A coding regions coding for the peptide from various viruses: foot-and-mouth disease virus, equine rhinitis A, Thosea asigna, porcine teschovirus-1. The porcine teschovirus 2A (P2A) had the highest efficiency of cleavage in three mammalian cell lines tested by Kim et al [1]: human, zebrafish and adult mice.
The P2A peptide can be used in a research context to allow multicistronic expression of genes without traditional methods of: multiple promoters, insertion of a splicing signal, insertion of a proteolytic cleavage site (e.g. TEV) and IRESs. Of note, P2A overcomes the limitations of an IRES: it is much smaller and also improves the translational efficiency of IRES-based genes [1]. The use of P2A is therefore useful to allow coexpression of large proteins in plasmids where the size of the insert is limiting and preserves the authenicity of a expressed protein sequence over traditionally cleaved protein in vitro such as TEV protease sites that leave a scar site.
Usage and Biology
The P2A sequence was added to our replicon between the MS2 coat protein and RdRp to separate it after translation from an upstream IRES, the P2A acts to reduce the size of the insert, reducing synthesis costs and complications in transformation and transfection.
Characterization by CPU_CHINA 2019
In order to determine the cleavage efficiency of P2A, 2019 CPU_CHINA iGEM team constructed TLR1(Part:BBa_K2976001), P2A self-cleaving peptide sequence (Part:BBa_K1442039) and TLR2 (Part:BBa_K2976002) together. Then, we integrated them into pcDNA6 vector and transfected the vector into HEK293T cells for co-expression of TLR1 and TLR2. The figure shows that the amount of TLR1 (A, B) and TLR2 (C, D) in the cells separately increased after transfection, which demonstrates that P2A exhibits efficient self-cleavage activity.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Characterization from the iGEM Team Hannover 2020
Motivation
The P2A peptide as well as an IRES enables the simultaneous expression of multiple coding regions under the control of one single promoter. Whereas the P2A peptide is a short coding region that is cloned in frame with the respective protein coding sequences and exhibits a peptide bond that is cleaved after translation, the IRES represents a noncoding region that forms a 3D secondary structure on the mRNA level which allows ribosome binding independent of the 5’-cap. But which solution should be used for a specific project? To answer this question, we checked P2A and IRES for expression levels of the upstream and downstream gene. The P2A peptide used in this approach (BBa_K3338003) is not identical with the basic part presented here but highly similar. The P2A peptide used here, lacks three N-terminal amino acids and exhibits an additional silent mutation. The lacking GSG-tripeptide is considered as an optional linker that might improve cleavage efficiency (Szymczak-Workman et al. 2012). Because of that the lacking amino acids are probably negligible.
Results
To compare the efficiency of the P2A peptide and the IRES (BBa_K3338004), we cloned P2A as well as IRES as a connector between EGFP and mCherry. Therefore, we amplified P2A and mCherry from the Addgene plasmid #45350 and IRES from the Addgene plasmid #72893 using primers with 20 bp overhangs suitable for NEBuilder® HiFi DNA Assembly cloning (for primers see table 1). The vector backbone was generated by linearizing the pEGFP-C2 vector with EcoRI and BamHI. The finished constructs were sequentially verified. Vector maps of both plasmids are shown in figure 1.
| Primer name | Sequence |
|---|---|
| P2A_fw | CGAGCTGTACAAGTCCGGCCGGACTCAGATCTCGAGCTCAgctactaacttcagcctgctga |
| P2A_rv | tcctcgcccttgctcaccataggtccagggtt |
| mCherry_fw for P2A | tggaggagaaccctggacctatggtgagcaag |
| mCherry_rv for P2A | TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGcttgtacagctcgtccatgcc |
| IRES_fw | TACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGCTTAGTAGGcccctctccctcccccccccctaac |
| IRES_rv | tcctcgcccttgctcaccatttatcatcgtgtttttcaaaggaaaaccacg |
| mCherry_fw for IRES | tttgaaaaacacgatgataaatggtgagcaagggcgag |
| mCherry_rv for IRES | TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGcttgtacagctcgtccatgcc |
Figure 1: Vector maps of EGFP-P2A-mCherry (A) and EGFP-IRES-mCherry (B) under control of the CMV-enhancer/promoter.
To compare the stoichiometry of simultaneous expression of both fluorescent proteins in the case of IRES and P2A, respectively, transfection of HeLa cells with either plasmid was performed by lipofection (ViaFect transfection reagent) or electroporation and fluorescence microscopy was used for subsequent analysis. The fluorescence intensities of mCherry and EGFP can be used to assess the expression of both proteins and are roughly comparable among themselves. The results in figure 2 indicate comparable fluorescence intensities of EGFP and mCherry for P2A. Furthermore, all cells exhibiting EGFP-expression also show mCherry expression. In contrast, in the case of IRES large differences in the fluorescence intensities of the EGFP and the mCherry channel were detected. In fact, the expression of EGFP, whose translation is initiated by the standard process involving the 5’-cap, is much higher than the mCherry expression from the IRES. Additionally, many EGFP positive cells did not show an mCherry signal. It is of note that the absolute EGFP expression is higher in the IRES construct whereas the absolute expression of mCherry is higher in the P2A construct. This might be due to the fact that the bigger protein in the P2A construct is produced with a lower efficiency.
Conclusions
Whether P2A or IRES should be used in a project depends on its goal. P2A is particularly well suited if it is important that both proteins are expressed strongly or comparably. IRES can be used if the expression of the upstream protein is to be indicated by a downstream reporter, since in this case a high expression of the first protein is particularly important.
References
Szymczak-Workman, A. L., Vignali, K. M., & Vignali, D. A. (2012). Design and construction of 2A peptide-linked multicistronic vectors. Cold Spring Harbor protocols, 2012(2), 199–204.