Difference between revisions of "Part:BBa K3558000"
Line 6: Line 6:
  
 
Small heat shock proteins (sHSP) are ATP-independent molecular chaperones which associate with misfolded proteins to prevent further aggregation when the cell is under thermal stress. They are therefore classified as “holdases”. (1) Proteins are functional when they are soluble in their environments. However, thermal stress exposes the protein hydrophobic core to the outside, rendering them insoluble. sHSPs reverse this process by binding to the exposed core and prevent them from becoming insoluble. The sHSP/substrate complex then prevents further aggregation of proteins and facilitates the binding of ATP-dependent HSPs for protein refolding. (2) sHSPs are ubiquitous across organisms as they have a high binding capacity, making them a suitable candidate in reversing heat shock. In addition, sHSP genes are upregulated by 1000 folds when they are exposed to cellular stress and this consequently can increase the activity of ATP-dependent chaperones by 80%. (3)
 
Small heat shock proteins (sHSP) are ATP-independent molecular chaperones which associate with misfolded proteins to prevent further aggregation when the cell is under thermal stress. They are therefore classified as “holdases”. (1) Proteins are functional when they are soluble in their environments. However, thermal stress exposes the protein hydrophobic core to the outside, rendering them insoluble. sHSPs reverse this process by binding to the exposed core and prevent them from becoming insoluble. The sHSP/substrate complex then prevents further aggregation of proteins and facilitates the binding of ATP-dependent HSPs for protein refolding. (2) sHSPs are ubiquitous across organisms as they have a high binding capacity, making them a suitable candidate in reversing heat shock. In addition, sHSP genes are upregulated by 1000 folds when they are exposed to cellular stress and this consequently can increase the activity of ATP-dependent chaperones by 80%. (3)
−
 
−
 
−
<!-- Add more about the biology of this part here
 
−
 
  
 
It was hypothesised that transforming small heat shock proteins 22E and 22F from Chlamydomonas reinhardtii (C. reinhardtii) into Symbiodinium would increase the thermal threshold of the latter microorganism. C. reinhardtii is a green algae which is stable at 42oC, (4) well above the bleaching threshold of Great Barrier Reef. (5,6) These sHSPs target the chloroplast, hence protecting the photosystems from reactive oxygen species produced by thermal shock. (4) As a result, the expulsion of Symbiodinium sp. from the coral tissue will be prevented and the rate of bleaching will decrease.  
 
It was hypothesised that transforming small heat shock proteins 22E and 22F from Chlamydomonas reinhardtii (C. reinhardtii) into Symbiodinium would increase the thermal threshold of the latter microorganism. C. reinhardtii is a green algae which is stable at 42oC, (4) well above the bleaching threshold of Great Barrier Reef. (5,6) These sHSPs target the chloroplast, hence protecting the photosystems from reactive oxygen species produced by thermal shock. (4) As a result, the expulsion of Symbiodinium sp. from the coral tissue will be prevented and the rate of bleaching will decrease.  
Line 16: Line 12:
  
 
The design, test, build cycle was utilised at multiple levels during this process. Following project design, experimental goals to characterise HSP22E and HSP22F were defined. This informed plasmid design and subsequent ‘build’ phases in the form of DNA cloning and purification and ‘test’ phases with characterising assays. The cycle was applied in order to adapt protocols to lab challenges and optimise conditions purifications and assays. The conclusions drawn from lab work this year will go on to inform future work in Phase II of the project.
 
The design, test, build cycle was utilised at multiple levels during this process. Following project design, experimental goals to characterise HSP22E and HSP22F were defined. This informed plasmid design and subsequent ‘build’ phases in the form of DNA cloning and purification and ‘test’ phases with characterising assays. The cycle was applied in order to adapt protocols to lab challenges and optimise conditions purifications and assays. The conclusions drawn from lab work this year will go on to inform future work in Phase II of the project.
 +
 +
 +
===Plasmid Design and Cloning===
 +
 +
<b> Plasmid Design with HSP22E and HSP22F Inserts <b>
 +
 +
DNA sequences for our genes of interest (HSP22E and HSP22F) were obtained from Genbank. Gene constructs for each were designed with the following features:
 +
Gibson forward and reverse overhangs - These were added onto both 5’ and 3’ ends of the gene sequences. The overhangs were complementary to the pET-19b plasmid backbone.
 +
Fwd: 5’ CGGCTGCTAACAAAGCCCGA 3’
 +
Rev: 5’ CTTTAAGAAGGAGATATACC 3’
 +
6x His-tag and GSG linker - The His-tag consisted of six histidines, which later allowed for protein purification using an affinity column. The GSG linker allowed for protein folding without interference by the 6xHis-tag.
 +
5’ GGCTCCGGCGGACATCATCATCATCACCATTAA 3’
 +
As the HSP22 genes were obtained from eukaryotic C. reinhardtii, gene constructs were codon optimised for E. coli using the IDT Codon Optimisation Tool. DNA g-blocks were synthesised from Integrated DNA Technologies (IDT).
 +
 +
Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG)  is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.
 +
 +
 +
[[File:T--iGEM20 UNSW Australia--plasmid.png|500px|thumb|center|pET-19b Plasmid (5717 bp)]]
 +
 +
 +
<b> Plasmid Assembly and Transformation <b>
 +
 +
The two gene constructs were inserted into linearised pET-19b plasmid backbone using Gibson assembly to form two different plasmid products. Plasmids were transformed into E.coli BL-21 using the heat shock method. These were plated onto ampicillin agar plates, alongside two negative controls, and incubated overnight. HSP22E transformation plates were found to have 7 viable colonies, while HSP22F transformation plates were found to have 10 viable colonies. 5 viable colonies from each were selected, patch plates were taken and glycerol stocks were made.
 +
 +
Colony PCR was performed and PCR products were visualised via DNA gel electrophoresis to identify which colonies contained the desired plasmid. Successful Gibson assembly and transformation is indicated in colony 5 (C5) for HSP22E and colonies 2-5 (C2-5) for HSP22F, seen in the bands boxed in (colour) at around 850 bp. Colonies 1 for both HSP22E and HSP22F showed slightly higher bands boxed in (colour) at around 1000 bp. These were also investigated in further steps.
 +
 +
 +
[[File:T--iGEM20 UNSW Australia--gel1.png|500px|thumb|center|Figure 1: DNA gel electrophoresis showing expected PCR products with HSP22E and HSP22F inserts amplified from designed plasmid construct. Pink boxes indicate bands at the expected 850 bp size, while green boxes indicate slightly larger 1000 bp inserts, upon comparison to the 1 kb+ DNA ladder.]]
 +
 +
 +
<b> Plasmid Purification and Sequencing <b>
 +
 +
HSP22E Colonies 1 and 5 (C1, C5) and HSP22F Colonies 1, 2 and 4 (C1, C2, C4) were selected to verify for successful Gibson and transformation. These colonies were grown up in larger cultures overnight. Plasmids were extracted and purified using the Qiagen QiaSpin Miniprep Kit. Samples were measured on the ThermoFisher NanoDrop Spectrophotometer to identify DNA concentration and purity.
 +
 +
 +
[[File:T--iGEM20 UNSW Australia--table1.png|500px|thumb|center|]]
 +
 +
 +
The successful Gibson assembly and transformation was further confirmed with Sanger sequencing at the Ramaciotti Centre for Genomics (UNSW, Sydney). Both forward and reverse sequencing reactions were submitted. Sequencing results analysis using the alignment tool on Benchling indicated high sequencing homology for all colonies. Sequences were identical to the original gene construct for HSP22E C5 and HSP22F C2 and C4. HSP22E C1 and HSP22F C1 had a high level of mismatched bases compared to the original sequence and were omitted from future steps.
 +
 +
 +
<b> Discussion <b>
 +
 +
The cloning process was successful and recombinant E. coli containing our designed plasmid were obtained. This was verified using PCR visualisation, NanoDrop photospectrometry and Sanger sequencing. A number of controls were used throughout this to ensure that only successful transformants were identified for future steps. When transforming the cells, two negative controls were also conducted. In these, water or just plasmid backbone were added to competent cells instead of the Gibson reaction. The water only negative control plate indicated 0 colonies, confirming that colonies on other plates weren’t due to contamination. Plasmid backbone only control plates grew 6 colonies, indicating that there were background circularised plasmid present. This is likely the explanation for the multiple bands at unexpected sizes seen in the DNA gel electrophoresis (C2-4 for HSP22E).
 +
 +
Additionally, when sequencing to confirm identity of the gene inserts, both a forward sequencing and reverse sequencing reaction was submitted for each colony. This ensured that sequencing errors would not affect results. This proved helpful when sequencing results for HSP22F Colony 2 (reverse primer) indicated the addition of a guanine base. However, this was not present in the forward sequencing reaction, and further inspection of the sequencing chromatogram confirmed that it was only a base calling error.
 +
 +
 +
 +
<!-- Add more about the biology of this part here
 +
 +
 +
  
  

Revision as of 12:13, 26 October 2020


Small Heat Shock Protein 22E (sHSP22E)

Usage and Biology

Small heat shock proteins (sHSP) are ATP-independent molecular chaperones which associate with misfolded proteins to prevent further aggregation when the cell is under thermal stress. They are therefore classified as “holdases”. (1) Proteins are functional when they are soluble in their environments. However, thermal stress exposes the protein hydrophobic core to the outside, rendering them insoluble. sHSPs reverse this process by binding to the exposed core and prevent them from becoming insoluble. The sHSP/substrate complex then prevents further aggregation of proteins and facilitates the binding of ATP-dependent HSPs for protein refolding. (2) sHSPs are ubiquitous across organisms as they have a high binding capacity, making them a suitable candidate in reversing heat shock. In addition, sHSP genes are upregulated by 1000 folds when they are exposed to cellular stress and this consequently can increase the activity of ATP-dependent chaperones by 80%. (3)

It was hypothesised that transforming small heat shock proteins 22E and 22F from Chlamydomonas reinhardtii (C. reinhardtii) into Symbiodinium would increase the thermal threshold of the latter microorganism. C. reinhardtii is a green algae which is stable at 42oC, (4) well above the bleaching threshold of Great Barrier Reef. (5,6) These sHSPs target the chloroplast, hence protecting the photosystems from reactive oxygen species produced by thermal shock. (4) As a result, the expulsion of Symbiodinium sp. from the coral tissue will be prevented and the rate of bleaching will decrease.

Due to limited lab time resulting from COVID-19 restrictions, lab work focused on characterising these novel molecular chaperones through recombinant expression in a standard laboratory chassis. Plasmid assembly and cloning into competent strains allowed for protein expression and purification of small heat shock proteins 22E and 22F. Functional assays demonstrated their ability to successfully reduce protein aggregation in thermal stress conditions.

The design, test, build cycle was utilised at multiple levels during this process. Following project design, experimental goals to characterise HSP22E and HSP22F were defined. This informed plasmid design and subsequent ‘build’ phases in the form of DNA cloning and purification and ‘test’ phases with characterising assays. The cycle was applied in order to adapt protocols to lab challenges and optimise conditions purifications and assays. The conclusions drawn from lab work this year will go on to inform future work in Phase II of the project.


Plasmid Design and Cloning

Plasmid Design with HSP22E and HSP22F Inserts <b>

DNA sequences for our genes of interest (HSP22E and HSP22F) were obtained from Genbank. Gene constructs for each were designed with the following features: Gibson forward and reverse overhangs - These were added onto both 5’ and 3’ ends of the gene sequences. The overhangs were complementary to the pET-19b plasmid backbone. Fwd: 5’ CGGCTGCTAACAAAGCCCGA 3’ Rev: 5’ CTTTAAGAAGGAGATATACC 3’ 6x His-tag and GSG linker - The His-tag consisted of six histidines, which later allowed for protein purification using an affinity column. The GSG linker allowed for protein folding without interference by the 6xHis-tag. 5’ GGCTCCGGCGGACATCATCATCATCACCATTAA 3’ As the HSP22 genes were obtained from eukaryotic C. reinhardtii, gene constructs were codon optimised for E. coli using the IDT Codon Optimisation Tool. DNA g-blocks were synthesised from Integrated DNA Technologies (IDT).

Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG) is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.


pET-19b Plasmid (5717 bp)


<b> Plasmid Assembly and Transformation <b>

The two gene constructs were inserted into linearised pET-19b plasmid backbone using Gibson assembly to form two different plasmid products. Plasmids were transformed into E.coli BL-21 using the heat shock method. These were plated onto ampicillin agar plates, alongside two negative controls, and incubated overnight. HSP22E transformation plates were found to have 7 viable colonies, while HSP22F transformation plates were found to have 10 viable colonies. 5 viable colonies from each were selected, patch plates were taken and glycerol stocks were made.

Colony PCR was performed and PCR products were visualised via DNA gel electrophoresis to identify which colonies contained the desired plasmid. Successful Gibson assembly and transformation is indicated in colony 5 (C5) for HSP22E and colonies 2-5 (C2-5) for HSP22F, seen in the bands boxed in (colour) at around 850 bp. Colonies 1 for both HSP22E and HSP22F showed slightly higher bands boxed in (colour) at around 1000 bp. These were also investigated in further steps.


Figure 1: DNA gel electrophoresis showing expected PCR products with HSP22E and HSP22F inserts amplified from designed plasmid construct. Pink boxes indicate bands at the expected 850 bp size, while green boxes indicate slightly larger 1000 bp inserts, upon comparison to the 1 kb+ DNA ladder.


<b> Plasmid Purification and Sequencing <b>

HSP22E Colonies 1 and 5 (C1, C5) and HSP22F Colonies 1, 2 and 4 (C1, C2, C4) were selected to verify for successful Gibson and transformation. These colonies were grown up in larger cultures overnight. Plasmids were extracted and purified using the Qiagen QiaSpin Miniprep Kit. Samples were measured on the ThermoFisher NanoDrop Spectrophotometer to identify DNA concentration and purity.


T--iGEM20 UNSW Australia--table1.png


The successful Gibson assembly and transformation was further confirmed with Sanger sequencing at the Ramaciotti Centre for Genomics (UNSW, Sydney). Both forward and reverse sequencing reactions were submitted. Sequencing results analysis using the alignment tool on Benchling indicated high sequencing homology for all colonies. Sequences were identical to the original gene construct for HSP22E C5 and HSP22F C2 and C4. HSP22E C1 and HSP22F C1 had a high level of mismatched bases compared to the original sequence and were omitted from future steps.


<b> Discussion <b>

The cloning process was successful and recombinant E. coli containing our designed plasmid were obtained. This was verified using PCR visualisation, NanoDrop photospectrometry and Sanger sequencing. A number of controls were used throughout this to ensure that only successful transformants were identified for future steps. When transforming the cells, two negative controls were also conducted. In these, water or just plasmid backbone were added to competent cells instead of the Gibson reaction. The water only negative control plate indicated 0 colonies, confirming that colonies on other plates weren’t due to contamination. Plasmid backbone only control plates grew 6 colonies, indicating that there were background circularised plasmid present. This is likely the explanation for the multiple bands at unexpected sizes seen in the DNA gel electrophoresis (C2-4 for HSP22E).

Additionally, when sequencing to confirm identity of the gene inserts, both a forward sequencing and reverse sequencing reaction was submitted for each colony. This ensured that sequencing errors would not affect results. This proved helpful when sequencing results for HSP22F Colony 2 (reverse primer) indicated the addition of a guanine base. However, this was not present in the forward sequencing reaction, and further inspection of the sequencing chromatogram confirmed that it was only a base calling error.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 1000
    COMPATIBLE WITH RFC[1000]