Difference between revisions of "Part:BBa K3570008"
| Line 16: | Line 16: | ||
<p> <strong>A. Protocols </strong></p><br> | <p> <strong>A. Protocols </strong></p><br> | ||
| − | <li><strong>Preparation of yeast competent cells</strong></li | + | <li><strong>Preparation of yeast competent cells</strong></li> |
<p>Fresh yeast were grown in 25ml of YPD medium overnight. This preculture was diluted to low OD<sub>600nm</sub> (e.g. 0.05) in 50ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD<sub>600nm</sub> of around 0.8. The 50ml of culture was transfered in a 50ml falcon-tube and was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 25ml of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. The tube was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 400µl of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. Yeast competent cells should be used on the same day that they have been prepared.</p><br> | <p>Fresh yeast were grown in 25ml of YPD medium overnight. This preculture was diluted to low OD<sub>600nm</sub> (e.g. 0.05) in 50ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD<sub>600nm</sub> of around 0.8. The 50ml of culture was transfered in a 50ml falcon-tube and was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 25ml of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. The tube was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 400µl of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. Yeast competent cells should be used on the same day that they have been prepared.</p><br> | ||
| − | <li><strong>Yeast transformation</strong></li | + | <li><strong>Yeast transformation</strong></li> |
<p>A mix in 1.5ml microcentrifuge tube was prepared with 2µl of transforming DNA (BBa_K3570000), 40µl of competente yeast cells , 25µg of carrier DNA (SS-DNA) and 168µl of 50% PEG in 100mM LiAc/TE. | <p>A mix in 1.5ml microcentrifuge tube was prepared with 2µl of transforming DNA (BBa_K3570000), 40µl of competente yeast cells , 25µg of carrier DNA (SS-DNA) and 168µl of 50% PEG in 100mM LiAc/TE. | ||
Positive control was the same mixture but the transforming DNA was replaced by 1uL of pR313 (a plasmid which have the HIS3 marker). The negative control was the same mixture but had no transforming DNA. | Positive control was the same mixture but the transforming DNA was replaced by 1uL of pR313 (a plasmid which have the HIS3 marker). The negative control was the same mixture but had no transforming DNA. | ||
After vortexing, the solution was incubated 45 minutes at 30°C. Then 13µl of DMS0 was added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatant was removed and the pellet was resuspended in 80µl of NaCl. The solution was seeded on petri dishe of YNB with all amino acids expect histidine. The petri dishe was incubated at 30°C for three days.</p><br> | After vortexing, the solution was incubated 45 minutes at 30°C. Then 13µl of DMS0 was added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatant was removed and the pellet was resuspended in 80µl of NaCl. The solution was seeded on petri dishe of YNB with all amino acids expect histidine. The petri dishe was incubated at 30°C for three days.</p><br> | ||
| − | <li><strong>Integration verification PCR</strong></li | + | <li><strong>Integration verification PCR</strong></li> |
<p>Verification of the integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit. Our insert was to big to be amplified by PCR. We therefore decided to amplified a part of 1200kb in the genome. The following primers have been used. The primer 1 (forward) hybridizes on our selectable marker HIS3 . The primer 2 (reverse) hybridizes on the 1,039,876 pb of the chromosome IV of the strain BY4741 (upstream of the DPP1 gene).</p> | <p>Verification of the integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit. Our insert was to big to be amplified by PCR. We therefore decided to amplified a part of 1200kb in the genome. The following primers have been used. The primer 1 (forward) hybridizes on our selectable marker HIS3 . The primer 2 (reverse) hybridizes on the 1,039,876 pb of the chromosome IV of the strain BY4741 (upstream of the DPP1 gene).</p> | ||
<p> Primer 1: ATCAGGATTTGCGCCTTT</p> | <p> Primer 1: ATCAGGATTTGCGCCTTT</p> | ||
Revision as of 12:07, 26 October 2020
HIS3 selection marker
Usage
HIS3 gene, found in the Saccharomyces cerevisiae yeast, encodes a protein called Imidazoleglycerol-phosphate dehydratase which catalyzes the sixth step in histidine biosynthesis(1). It is analogous to hisB in Escherichia coli.
HIS3 gene serves as a commonly used yeast selectable marker. When HIS3 gene is inserted into an integrative or replicative plasmid, HIS3 allows to counter-select the cells that acquired the prototroph character for histidine so that they can grow without histidine addition in the medium. Those cells should not have the functional HIS3 gene in its genome[1].
The sequence contains HIS3 specific promoter, HIS3 coding sequence, and HIS3 terminator. This sequence was taken from RS313 plasmid [3].
Experiments
We used this part in the insertion of the tHMG1 and CrtE genes (part BBa_K3570000) in the yeast genome. Below is our yeast transformation protocol and our results which show that we have successfully integrated this part and that the BBa_K3570008 works.
A. Protocols
Fresh yeast were grown in 25ml of YPD medium overnight. This preculture was diluted to low OD600nm (e.g. 0.05) in 50ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD600nm of around 0.8. The 50ml of culture was transfered in a 50ml falcon-tube and was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 25ml of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. The tube was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 400µl of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. Yeast competent cells should be used on the same day that they have been prepared.
A mix in 1.5ml microcentrifuge tube was prepared with 2µl of transforming DNA (BBa_K3570000), 40µl of competente yeast cells , 25µg of carrier DNA (SS-DNA) and 168µl of 50% PEG in 100mM LiAc/TE. Positive control was the same mixture but the transforming DNA was replaced by 1uL of pR313 (a plasmid which have the HIS3 marker). The negative control was the same mixture but had no transforming DNA. After vortexing, the solution was incubated 45 minutes at 30°C. Then 13µl of DMS0 was added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatant was removed and the pellet was resuspended in 80µl of NaCl. The solution was seeded on petri dishe of YNB with all amino acids expect histidine. The petri dishe was incubated at 30°C for three days.
Verification of the integration of BBa_K3570000 using the DPP1 homology sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit. Our insert was to big to be amplified by PCR. We therefore decided to amplified a part of 1200kb in the genome. The following primers have been used. The primer 1 (forward) hybridizes on our selectable marker HIS3 . The primer 2 (reverse) hybridizes on the 1,039,876 pb of the chromosome IV of the strain BY4741 (upstream of the DPP1 gene).
Primer 1: ATCAGGATTTGCGCCTTT
Primer 2: GCCGCCGAGGGTATTTTACTTCCG
B. Results and discussion
Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes SbfI and EcoRI and purified to transform the yeast Saccharomyces cerevisiae resulting in th strain BY4741 DPP::tHMG1-crtE. The yeast was then grown on YNB with all amino acids expect histidine for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate. We randomly chose eight clones from our transformation and one from the positive control plate (see on the figure 1 below) for PCR verification integration.
All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band. These two verifications proved that we have successfully integrated tHmg1 and CrtE into the yeast using the selectable marker HIS3!
References
- [1]- Old, R. W., & Primrose, S. B. (1981). Principles of gene manipulation: an introduction to genetic engineering (Vol. 2). Univ of California Press.
- [2]- GenBank: U03439.1
- [3]- RS313 plasmid
- [4]- SGD:S000005728
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 1005
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 896
Illegal BglII site found at 956 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]