Difference between revisions of "Part:BBa K3416101"
WiseauTommy (Talk | contribs) (→Biology) |
WiseauTommy (Talk | contribs) (→Biology) |
||
| Line 15: | Line 15: | ||
<figure one> <figure description> | <figure one> <figure description> | ||
| − | To develop the <i>F. columnare</i> LFA test based on 16S rRNA gene these parts are needed: <b>BBa_K3416101</b>, [https://parts.igem.org/Part:BBa_K3416102 <b>BBa_K3416102</b>], [https://parts.igem.org/Part:BBa_K3416103 <b>BBa_K3416103</b>]. Primers to amplify a fragment of 16S rRNA are: F.Col.16S 5’GGATAGCCCAGAGAAATTTGGA3’ and R.Col.16S 5’CAT CTT GTA CCG TTG GAA CTT TAA T3’. In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania Vilnius-Lithuania iGEM 2020 team wiki]page. | + | To develop the <i>F. columnare</i> LFA test based on 16S rRNA gene these parts are needed: <b>BBa_K3416101</b>, [https://parts.igem.org/Part:BBa_K3416102 <b>BBa_K3416102</b>], [https://parts.igem.org/Part:BBa_K3416103 <b>BBa_K3416103</b>]. Primers to amplify a fragment of 16S rRNA are: F.Col.16S 5’GGATAGCCCAGAGAAATTTGGA3’ and R.Col.16S 5’CAT CTT GTA CCG TTG GAA CTT TAA T3’. In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania Vilnius-Lithuania iGEM 2020 team wiki] page. |
Revision as of 21:46, 24 October 2020
F. columnare LFA detection probe (16S rRNR)
Introduction
Biology
Description of 16S F. columnare detection probe
Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacteria identification and detection purposes. F. columnare causes columnaris disease in freshwater fish. The infection results in skin and fin erosions as well as gill necrosis and eventually leads to death1. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.
Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.
Usually, for phylogenetic analysis and identification 16S rRNA gene can be used2. For this reason, we developed LFA probes based on this gene sequence. F. columnare 16S rRNA gene (AY577821) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for F. columnare LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).
<figure one> <figure description>
To develop the F. columnare LFA test based on 16S rRNA gene these parts are needed: BBa_K3416101, BBa_K3416102, BBa_K3416103. Primers to amplify a fragment of 16S rRNA are: F.Col.16S 5’GGATAGCCCAGAGAAATTTGGA3’ and R.Col.16S 5’CAT CTT GTA CCG TTG GAA CTT TAA T3’. In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.