Difference between revisions of "Collections/Immune Regulation"

(Sense & Control)
Line 4: Line 4:
  
 
===Sense & Control===
 
===Sense & Control===
 +
Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules
 
<parttable>coll_immune_regulation_sense</parttable>
 
<parttable>coll_immune_regulation_sense</parttable>
  
 
===Inflammatory===
 
===Inflammatory===
 +
This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).
 
<parttable>coll_immune_regulation_inflammatory</parttable>
 
<parttable>coll_immune_regulation_inflammatory</parttable>
  
  
 
===Receptors===
 
===Receptors===
 +
This set contains some membrane receptors.
 
<parttable>coll_immune_regulation_receptors</parttable>
 
<parttable>coll_immune_regulation_receptors</parttable>
  
Line 16: Line 19:
  
 
===Antibodies===
 
===Antibodies===
 +
Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.
 
<parttable>coll_immune_regulation_antibodies</parttable>
 
<parttable>coll_immune_regulation_antibodies</parttable>
  
  
 
===Others===
 
===Others===
 +
This set contains other miscellaneous molecules whose functions are related to the immune system.
 
<parttable>coll_immune_regulation_others</parttable>
 
<parttable>coll_immune_regulation_others</parttable>

Revision as of 18:52, 23 October 2020


Sense & Control

Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1799015pYeaRRegulatoryWill Shindel100  . . . aatgcaaattatcaggcgtaccctgaaacg
BBa_K203111Constitutive promoter; 2 REURegulatoryLars Velten, Simon Haas, Hannah Meyer, Anne Rademacher, Hannah Uckelmann and Corinna Hiller426  . . . gccgggatttgggtcgcggttcttgtttgt
BBa_K256004NorRCodingiGEM09_NTU-Singapore15156 . . . ctggcgaaacgtctgggattgaaggattaa
BBa_K2976009NF-κB induced promoterRegulatoryJiatong Chen1092 . . . gtacggtgggaggtctatataagcagagct
BBa_K3244013NFAT-Response EllementRegulatoryMohammad Tarek Mansour1171 . . . ttcatacagaaggcgttcaagcttgtcgac
BBa_K3244014IL-2 PromoterRegulatoryMohammad Tarek Mansour1141 . . . atcactactcacagtaacctcaactcctgc
BBa_K554000SoxS promoterRegulatoryUNICAMP_EMSE Brazil team627 . . . atactccccaacagatgaattaacgaactg
BBa_K554003SoxRCodingUNICAMP EMSE Brazil team4837 . . . cgcttgctggaagatgaacaaaactaataa

Inflammatory

This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1228004A fragment of loctoferrin CodingZhang SW75  . . . ccgagcattacctgcgtgcgtcgcgccttt
BBa_K1319003human galectin-3, codon optimized for E. coliCodingMichael Osthege753  . . . acctctgccagctacaccatgatctaataa
BBa_K1611000IFNgammaCodingFrederic Ros471  . . . aggaagcggaaaaggagtcgctgctgataa
BBa_K1728004IL8 partial sequenceRNAYung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu1021 . . . tagggttgccagatgcaatacaagattcct
BBa_K1728005IL1β partial sequenceRNAYung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu891 . . . ttcttcgacacatgggataacgaggcttat
BBa_K1929300Interleukin-2 (IL-2) with designed RBSCodingMaxwell Ng6461 . . . ttctgcgtttatactcgagctgcgtttata
BBa_K223053hIL-6 Generator (Freiburg-compatible)GeneratorAnusuya Ramasubramanian620  . . . accggttaatactagtagcggccgctgcag
BBa_K2520045Bee venom PLA epitope 1Protein_DomainDana Kadosh361 . . . cactacaccgtggacaagtccaagcccaag
BBa_K2653015TNF-αCodingJiaxin Ma734  . . . gaccaaggtggaaatcaaacgggcggccgc
BBa_K2817004Myrosinase (horseradish)CodingZhaoyu Liu1533  . . . aaatggttctctaaattcctggctaaataa
BBa_K2876014IL1BCodingEleanor Glockner807  . . . accgattttaccatgcagtttgtgagcagc
BBa_K2913019TNF-αCodingYuhan Liu, Yannan Wang1383  . . . acgaaaggctcagtcgaaagactgggcctt
BBa_K2924028β-caseinCodingMelanie Sbielut, Andreas Nakielski702  . . . ggatcccaccaccaccaccaccactaataa
BBa_K2924041Lactoferrin CodingMelanie Sbielut 10551 . . . tatctgacgacactgaaaaatttgcgtgaa
BBa_K2957000IL-8 (CXCL8) CodingCloning Team (Melody, Margaret, Krissy, Ethan)3144 . . . tcttgaaaagggccgaaaactcataagctt
BBa_K2957094C5aCodingYe Cheng Zheng3066  . . . gcagaagatatcttcctgaatggatgctaa
BBa_K2986014Interleukin 10Codingzheng shuxin5341 . . . gaagcctacatgacaatgaagatacgaaac
BBa_K2986015Interleukin 8DNAzheng shuxin2971 . . . gagaagtttttgaagagggctgagaactca
BBa_K3009001FPR2 receptorSignallingCarolin Ruckes10592 . . . gctgagacagaactccaagcgatgatcgat
BBa_K3078005LL-37CodingZiang Guo1172 . . . cgtaatctggttccgcgtaccgaaagctaa
BBa_K3132017human interleukine 15CodingQiliang Yang373  . . . cacatcgtccagatgttcatcaataccagc
BBa_K3234000Human interleukin 2CodingYuxin Huang399  . . . ttcgcccagagcatcatcagcacgctgacc
BBa_K3244015IL-18CodingMohammad Tarek Mansour5791 . . . agcatcatgttcaccgtgcagaacgaggac
BBa_K554004IL10CodingUNICAMP EMSE Brazil team5041 . . . tacatgacgatgaaaatccgtaactaataa


Receptors

This set contains some membrane receptors.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1391002CD79ACodingAlexa Garcia684  . . . ggagatgtccagctggagaagccgtagtag
BBa_K1391003CD79BCodingAlexa Garcia693  . . . gtaggtgagcacccaggccaggagtagtag
BBa_K1993001CCR7CodingSu Xiaojun1137  . . . gccgagaccaccaccaccttctccccatag
BBa_K1993002CXCR1CodingZhou Longyuan 1053  . . . tcgtctgtcaatgtctcttccaacctctga
BBa_K1993003CXCR4CodingSu Xiaojun10712 . . . tctgagtcttcaagttttcactccagctaa
BBa_K1993004CCR5CodingSu Xiaojun1059  . . . ggggagcaggaaatatctgtgggcttgtga
BBa_K1993012CCR2CodingSu Xiaojun1125  . . . gccagtcttcaggacaaagaaggagcctag
BBa_K1993013CXCR5CodingSu Xiaojun11191 . . . gagaatgccacctctctcaccacgttctag
BBa_K2549001suface-expressed CD19CodingRongrong Du10831 . . . ttgatcatgctttggcagaagaaacctaga
BBa_K2583000HRH4_CDSCodingLiuJie11936 . . . atcttcttaaaagctttggacttcttcgcc
BBa_K2976000Toll-like receptor 1CodingJiatong Chen54  . . . tgcggcgacgtggaggagaaccccggcccc
BBa_K2976001Toll-like receptor 1CodingJiatong Chen23611 . . . attaagctgacagagcaagcaaagaaatga
BBa_K2976002Toll-like receptor 2 CodingJiatong Chen23581 . . . aatctgagagctgcgataaagtcctgatga
BBa_K2976003Cluster of differentiation 14 (CD14)CodingJiatong Chen11281 . . . ctgctccaaggggcccggggctttgcctaa
BBa_K321004intracellular chain of KIR3DL1Protein_DomainHannah Yan2401 . . . aagcccagatccaaagttgtctcctgccca


Antibodies

Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1071007Hep B Antibody light chainCodingTeam Marburg 2013711  . . . acaaagagcttcaaccgtggagagtgttag
BBa_K1071008Hep B Antibody heavy chainCodingTeam Marburg 201314043 . . . aagagcctctccctgtctccgggtaaatga
BBa_K1391000Gantenerumab Variable Human Ig-M Heavy ChainCodingAlexa Garcia1860  . . . accgtgaccctctttaaggtgaagtagtag
BBa_K1391001Gantenerumab Variable Human Ig-M Light ChainCodingAlexa Garcia720  . . . aagagctttaacaggggggagtgctagtag
BBa_K1694003Single-chain variable fragment (Anti-VEGF) CodingCHIH-HSUAN HSU7472 . . . cagggcaccctggttaccgtgagcagttaa
BBa_K1694004Single-chain variable fragment (Anti-EGFR)CodingCHIH-HSUAN HSU7351 . . . cagggcaccctggtgacagtgagtgcataa
BBa_K1694005Single-chain variable fragment (Anti-HER2)CodingCHIH-HSUAN HSU5822 . . . acctctgaagattctgcggtctattactgt
BBa_K1933004constitutive promoter and RBSRegulatoryTomoki Uchino 606 . . . ctagcactagagaaagaggagaaatactag
BBa_K2247006Single-chain variable fragment 1 of anti-Aflatoxin B1 antibody (antiAFB1-ScFv1)CodingJianing Han7321 . . . ggggggaccaagctggagctgaaacggtag
BBa_K2520001Single Chain Fragment Variable (scFv) of rat anti-murine IgM antibodyCodingNoa Eden, Dana Kadosh699  . . . tggggccaaggagtcatggtcacagtctcc
BBa_K2520043Celiac epitope 1 Protein_DomainDana Kadosh271cccttcccccagccccagctgccctac
BBa_K2520044Celiac epitope 3Protein_DomainDana Kadosh271ccctacccccagccccagctgccctac
BBa_K2622004scFv_antiVGYCodingAuksė Gaiauskaitė733  . . . gcagggcacatccgtgacggtatcgtcagc
BBa_K2876007anti-aflatoxinB1 ScFv1CodingEleanor Glockner732  . . . ggggggaccaagctggagctgaaacggtag
BBa_K2876011IL-1 Beta scFv2CodingEleanor Glockner720  . . . ggccagggcaccctggtgaccgtgagcagc
BBa_K2876015anti-IL1B scFv1CodingEleanor Glockner772  . . . cgtgagcagctaaggatcctctacgccgga
BBa_K2946000scFv (Single-Chain Variable Fragment)Protein_Domaineden asraf8101 . . . ggccaaggcacatccgtaaccgtaagctca
BBa_K3064009mmuIgG-FcCodingJie Cai5282 . . . ctgacctgcatgataacagacttcttccct
BBa_K3090001single chain variable fragment (scFv(P5))DNAJungwoo Choe7171 . . . ggtggtggaactaaattggagatcaagcgc
BBa_K3090002single chain variable fragment (scFv(P5)) with cppDNAJungwoo Choe768  . . . ggtggtggaactaaattggagatcaagcgc
BBa_K3117039kappa light chainProtein_DomainLena Schorr3212 . . . gtaaccaaatccttcaaccgtggtgaatgc
BBa_K3117040constant region 1 (CH1) of an antibodyProtein_DomainLena Schorr3242 . . . gagccgaaatcttgcgataaaactcatact
BBa_K3132005anti-HER2 scFVCodingQiliang Yang697  . . . ggaggaggaacaaagctgacggttcttgga
BBa_K3346000Siltuximab Heavy Variable Chain for IgGCodingEmily Laskey328-1 . . . gcctgtggggctattatgcgctggattatt
BBa_T2018V5 epitope tag tail domain (GKPIPNPLLGLDST)Protein_DomainReshma Shetty48  . . . ccgctcctgggcctcgattccacgtaataa
BBa_T2019V5 epitope tag head domain (GKPIPNPLLGLDST)Protein_DomainReshma Shetty48  . . . ccgaacccgctcctgggcctcgattccacg
BBa_T2020V5 epitope tag special internal domain (GKPIPNPLLGLDST)Protein_DomainReshma Shetty42  . . . ccgaacccgctcctgggcctcgattccacg


Others

This set contains other miscellaneous molecules whose functions are related to the immune system.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1686045crdA gene with codon optimisation for E. coliCodingJean Descarpentrie1458  . . . caaacgaagatttcccgtacgcagagctaa
BBa_K1686047crdC gene with codon optimisation for E. coli CodingJean Descarpentrie1266  . . . ggtgtatcatcaatgcatgaagctgagtaa
BBa_K2226003COX-2 geneDNAAn-Chi Tsai7561 . . . aaatttttggaatgattaaatgaacaataa
BBa_K2309021LL-37 for Lactococcus lactis NZ9000 (codon optimized)CodingZixin Rong1204 . . . aaccttgttccacgtactgaatcataataa
BBa_K2539250ALDH2*2 Basic PartCodingCatherine Chang15542 . . . acagtcaaagtgcctcagaagaactcataa
BBa_K2885000Protien G (ProG)CodingSungho Ko5552 . . . gacgcgactaaaacttttaccgttaccgaa
BBa_K2976006Anti-PD-L1 peptideCodingJiatong Chen721 . . . gtgcgccgcatcgaggacatgatgaaccag
BBa_K380010Immunoglobulin G protease (IdeS)CodingNina Schiller930  . . . acagggcaagatagttggaatcagaccaat