Difference between revisions of "Collections/Immune Regulation"
Soumo sarkar (Talk | contribs) (→Sense & Control) |
Soumo sarkar (Talk | contribs) |
||
Line 4: | Line 4: | ||
===Sense & Control=== | ===Sense & Control=== | ||
+ | Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules | ||
<parttable>coll_immune_regulation_sense</parttable> | <parttable>coll_immune_regulation_sense</parttable> | ||
===Inflammatory=== | ===Inflammatory=== | ||
+ | This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both). | ||
<parttable>coll_immune_regulation_inflammatory</parttable> | <parttable>coll_immune_regulation_inflammatory</parttable> | ||
===Receptors=== | ===Receptors=== | ||
+ | This set contains some membrane receptors. | ||
<parttable>coll_immune_regulation_receptors</parttable> | <parttable>coll_immune_regulation_receptors</parttable> | ||
Line 16: | Line 19: | ||
===Antibodies=== | ===Antibodies=== | ||
+ | Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used. | ||
<parttable>coll_immune_regulation_antibodies</parttable> | <parttable>coll_immune_regulation_antibodies</parttable> | ||
===Others=== | ===Others=== | ||
+ | This set contains other miscellaneous molecules whose functions are related to the immune system. | ||
<parttable>coll_immune_regulation_others</parttable> | <parttable>coll_immune_regulation_others</parttable> |
Revision as of 18:52, 23 October 2020
Sense & Control
Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1799015 | pYeaR | Regulatory | Will Shindel | 100 | . . . aatgcaaattatcaggcgtaccctgaaacg | |
BBa_K203111 | Constitutive promoter; 2 REU | Regulatory | Lars Velten, Simon Haas, Hannah Meyer, Anne Rademacher, Hannah Uckelmann and Corinna Hiller | 426 | . . . gccgggatttgggtcgcggttcttgtttgt | |
BBa_K256004 | NorR | Coding | iGEM09_NTU-Singapore | 1515 | 6 | . . . ctggcgaaacgtctgggattgaaggattaa |
BBa_K2976009 | NF-κB induced promoter | Regulatory | Jiatong Chen | 109 | 2 | . . . gtacggtgggaggtctatataagcagagct |
BBa_K3244013 | NFAT-Response Ellement | Regulatory | Mohammad Tarek Mansour | 117 | 1 | . . . ttcatacagaaggcgttcaagcttgtcgac |
BBa_K3244014 | IL-2 Promoter | Regulatory | Mohammad Tarek Mansour | 114 | 1 | . . . atcactactcacagtaacctcaactcctgc |
BBa_K554000 | SoxS promoter | Regulatory | UNICAMP_EMSE Brazil team | 62 | 7 | . . . atactccccaacagatgaattaacgaactg |
BBa_K554003 | SoxR | Coding | UNICAMP EMSE Brazil team | 483 | 7 | . . . cgcttgctggaagatgaacaaaactaataa |
Inflammatory
This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1228004 | A fragment of loctoferrin | Coding | Zhang SW | 75 | . . . ccgagcattacctgcgtgcgtcgcgccttt | |
BBa_K1319003 | human galectin-3, codon optimized for E. coli | Coding | Michael Osthege | 753 | . . . acctctgccagctacaccatgatctaataa | |
BBa_K1611000 | IFNgamma | Coding | Frederic Ros | 471 | . . . aggaagcggaaaaggagtcgctgctgataa | |
BBa_K1728004 | IL8 partial sequence | RNA | Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu | 102 | 1 | . . . tagggttgccagatgcaatacaagattcct |
BBa_K1728005 | IL1β partial sequence | RNA | Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu | 89 | 1 | . . . ttcttcgacacatgggataacgaggcttat |
BBa_K1929300 | Interleukin-2 (IL-2) with designed RBS | Coding | Maxwell Ng | 646 | 1 | . . . ttctgcgtttatactcgagctgcgtttata |
BBa_K223053 | hIL-6 Generator (Freiburg-compatible) | Generator | Anusuya Ramasubramanian | 620 | . . . accggttaatactagtagcggccgctgcag | |
BBa_K2520045 | Bee venom PLA epitope 1 | Protein_Domain | Dana Kadosh | 36 | 1 | . . . cactacaccgtggacaagtccaagcccaag |
BBa_K2653015 | TNF-α | Coding | Jiaxin Ma | 734 | . . . gaccaaggtggaaatcaaacgggcggccgc | |
BBa_K2817004 | Myrosinase (horseradish) | Coding | Zhaoyu Liu | 1533 | . . . aaatggttctctaaattcctggctaaataa | |
BBa_K2876014 | IL1B | Coding | Eleanor Glockner | 807 | . . . accgattttaccatgcagtttgtgagcagc | |
BBa_K2913019 | TNF-α | Coding | Yuhan Liu, Yannan Wang | 1383 | . . . acgaaaggctcagtcgaaagactgggcctt | |
BBa_K2924028 | β-casein | Coding | Melanie Sbielut, Andreas Nakielski | 702 | . . . ggatcccaccaccaccaccaccactaataa | |
BBa_K2924041 | Lactoferrin | Coding | Melanie Sbielut | 1055 | 1 | . . . tatctgacgacactgaaaaatttgcgtgaa |
BBa_K2957000 | IL-8 (CXCL8) | Coding | Cloning Team (Melody, Margaret, Krissy, Ethan) | 314 | 4 | . . . tcttgaaaagggccgaaaactcataagctt |
BBa_K2957094 | C5a | Coding | Ye Cheng Zheng | 3066 | . . . gcagaagatatcttcctgaatggatgctaa | |
BBa_K2986014 | Interleukin 10 | Coding | zheng shuxin | 534 | 1 | . . . gaagcctacatgacaatgaagatacgaaac |
BBa_K2986015 | Interleukin 8 | DNA | zheng shuxin | 297 | 1 | . . . gagaagtttttgaagagggctgagaactca |
BBa_K3009001 | FPR2 receptor | Signalling | Carolin Ruckes | 1059 | 2 | . . . gctgagacagaactccaagcgatgatcgat |
BBa_K3078005 | LL-37 | Coding | Ziang Guo | 117 | 2 | . . . cgtaatctggttccgcgtaccgaaagctaa |
BBa_K3132017 | human interleukine 15 | Coding | Qiliang Yang | 373 | . . . cacatcgtccagatgttcatcaataccagc | |
BBa_K3234000 | Human interleukin 2 | Coding | Yuxin Huang | 399 | . . . ttcgcccagagcatcatcagcacgctgacc | |
BBa_K3244015 | IL-18 | Coding | Mohammad Tarek Mansour | 579 | 1 | . . . agcatcatgttcaccgtgcagaacgaggac |
BBa_K554004 | IL10 | Coding | UNICAMP EMSE Brazil team | 504 | 1 | . . . tacatgacgatgaaaatccgtaactaataa |
Receptors
This set contains some membrane receptors.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1391002 | CD79A | Coding | Alexa Garcia | 684 | . . . ggagatgtccagctggagaagccgtagtag | |
BBa_K1391003 | CD79B | Coding | Alexa Garcia | 693 | . . . gtaggtgagcacccaggccaggagtagtag | |
BBa_K1993001 | CCR7 | Coding | Su Xiaojun | 1137 | . . . gccgagaccaccaccaccttctccccatag | |
BBa_K1993002 | CXCR1 | Coding | Zhou Longyuan | 1053 | . . . tcgtctgtcaatgtctcttccaacctctga | |
BBa_K1993003 | CXCR4 | Coding | Su Xiaojun | 1071 | 2 | . . . tctgagtcttcaagttttcactccagctaa |
BBa_K1993004 | CCR5 | Coding | Su Xiaojun | 1059 | . . . ggggagcaggaaatatctgtgggcttgtga | |
BBa_K1993012 | CCR2 | Coding | Su Xiaojun | 1125 | . . . gccagtcttcaggacaaagaaggagcctag | |
BBa_K1993013 | CXCR5 | Coding | Su Xiaojun | 1119 | 1 | . . . gagaatgccacctctctcaccacgttctag |
BBa_K2549001 | suface-expressed CD19 | Coding | Rongrong Du | 1083 | 1 | . . . ttgatcatgctttggcagaagaaacctaga |
BBa_K2583000 | HRH4_CDS | Coding | LiuJie | 1193 | 6 | . . . atcttcttaaaagctttggacttcttcgcc |
BBa_K2976000 | Toll-like receptor 1 | Coding | Jiatong Chen | 54 | . . . tgcggcgacgtggaggagaaccccggcccc | |
BBa_K2976001 | Toll-like receptor 1 | Coding | Jiatong Chen | 2361 | 1 | . . . attaagctgacagagcaagcaaagaaatga |
BBa_K2976002 | Toll-like receptor 2 | Coding | Jiatong Chen | 2358 | 1 | . . . aatctgagagctgcgataaagtcctgatga |
BBa_K2976003 | Cluster of differentiation 14 (CD14) | Coding | Jiatong Chen | 1128 | 1 | . . . ctgctccaaggggcccggggctttgcctaa |
BBa_K321004 | intracellular chain of KIR3DL1 | Protein_Domain | Hannah Yan | 240 | 1 | . . . aagcccagatccaaagttgtctcctgccca |
Antibodies
Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1071007 | Hep B Antibody light chain | Coding | Team Marburg 2013 | 711 | . . . acaaagagcttcaaccgtggagagtgttag | |
BBa_K1071008 | Hep B Antibody heavy chain | Coding | Team Marburg 2013 | 1404 | 3 | . . . aagagcctctccctgtctccgggtaaatga |
BBa_K1391000 | Gantenerumab Variable Human Ig-M Heavy Chain | Coding | Alexa Garcia | 1860 | . . . accgtgaccctctttaaggtgaagtagtag | |
BBa_K1391001 | Gantenerumab Variable Human Ig-M Light Chain | Coding | Alexa Garcia | 720 | . . . aagagctttaacaggggggagtgctagtag | |
BBa_K1694003 | Single-chain variable fragment (Anti-VEGF) | Coding | CHIH-HSUAN HSU | 747 | 2 | . . . cagggcaccctggttaccgtgagcagttaa |
BBa_K1694004 | Single-chain variable fragment (Anti-EGFR) | Coding | CHIH-HSUAN HSU | 735 | 1 | . . . cagggcaccctggtgacagtgagtgcataa |
BBa_K1694005 | Single-chain variable fragment (Anti-HER2) | Coding | CHIH-HSUAN HSU | 582 | 2 | . . . acctctgaagattctgcggtctattactgt |
BBa_K1933004 | constitutive promoter and RBS | Regulatory | Tomoki Uchino | 60 | 6 | . . . ctagcactagagaaagaggagaaatactag |
BBa_K2247006 | Single-chain variable fragment 1 of anti-Aflatoxin B1 antibody (antiAFB1-ScFv1) | Coding | Jianing Han | 732 | 1 | . . . ggggggaccaagctggagctgaaacggtag |
BBa_K2520001 | Single Chain Fragment Variable (scFv) of rat anti-murine IgM antibody | Coding | Noa Eden, Dana Kadosh | 699 | . . . tggggccaaggagtcatggtcacagtctcc | |
BBa_K2520043 | Celiac epitope 1 | Protein_Domain | Dana Kadosh | 27 | 1 | cccttcccccagccccagctgccctac |
BBa_K2520044 | Celiac epitope 3 | Protein_Domain | Dana Kadosh | 27 | 1 | ccctacccccagccccagctgccctac |
BBa_K2622004 | scFv_antiVGY | Coding | Auksė Gaiauskaitė | 733 | . . . gcagggcacatccgtgacggtatcgtcagc | |
BBa_K2876007 | anti-aflatoxinB1 ScFv1 | Coding | Eleanor Glockner | 732 | . . . ggggggaccaagctggagctgaaacggtag | |
BBa_K2876011 | IL-1 Beta scFv2 | Coding | Eleanor Glockner | 720 | . . . ggccagggcaccctggtgaccgtgagcagc | |
BBa_K2876015 | anti-IL1B scFv1 | Coding | Eleanor Glockner | 772 | . . . cgtgagcagctaaggatcctctacgccgga | |
BBa_K2946000 | scFv (Single-Chain Variable Fragment) | Protein_Domain | eden asraf | 810 | 1 | . . . ggccaaggcacatccgtaaccgtaagctca |
BBa_K3064009 | mmuIgG-Fc | Coding | Jie Cai | 528 | 2 | . . . ctgacctgcatgataacagacttcttccct |
BBa_K3090001 | single chain variable fragment (scFv(P5)) | DNA | Jungwoo Choe | 717 | 1 | . . . ggtggtggaactaaattggagatcaagcgc |
BBa_K3090002 | single chain variable fragment (scFv(P5)) with cpp | DNA | Jungwoo Choe | 768 | . . . ggtggtggaactaaattggagatcaagcgc | |
BBa_K3117039 | kappa light chain | Protein_Domain | Lena Schorr | 321 | 2 | . . . gtaaccaaatccttcaaccgtggtgaatgc |
BBa_K3117040 | constant region 1 (CH1) of an antibody | Protein_Domain | Lena Schorr | 324 | 2 | . . . gagccgaaatcttgcgataaaactcatact |
BBa_K3132005 | anti-HER2 scFV | Coding | Qiliang Yang | 697 | . . . ggaggaggaacaaagctgacggttcttgga | |
BBa_K3346000 | Siltuximab Heavy Variable Chain for IgG | Coding | Emily Laskey | 328 | -1 | . . . gcctgtggggctattatgcgctggattatt |
BBa_T2018 | V5 epitope tag tail domain (GKPIPNPLLGLDST) | Protein_Domain | Reshma Shetty | 48 | . . . ccgctcctgggcctcgattccacgtaataa | |
BBa_T2019 | V5 epitope tag head domain (GKPIPNPLLGLDST) | Protein_Domain | Reshma Shetty | 48 | . . . ccgaacccgctcctgggcctcgattccacg | |
BBa_T2020 | V5 epitope tag special internal domain (GKPIPNPLLGLDST) | Protein_Domain | Reshma Shetty | 42 | . . . ccgaacccgctcctgggcctcgattccacg |
Others
This set contains other miscellaneous molecules whose functions are related to the immune system.
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K1686045 | crdA gene with codon optimisation for E. coli | Coding | Jean Descarpentrie | 1458 | . . . caaacgaagatttcccgtacgcagagctaa | |
BBa_K1686047 | crdC gene with codon optimisation for E. coli | Coding | Jean Descarpentrie | 1266 | . . . ggtgtatcatcaatgcatgaagctgagtaa | |
BBa_K2226003 | COX-2 gene | DNA | An-Chi Tsai | 756 | 1 | . . . aaatttttggaatgattaaatgaacaataa |
BBa_K2309021 | LL-37 for Lactococcus lactis NZ9000 (codon optimized) | Coding | Zixin Rong | 120 | 4 | . . . aaccttgttccacgtactgaatcataataa |
BBa_K2539250 | ALDH2*2 Basic Part | Coding | Catherine Chang | 1554 | 2 | . . . acagtcaaagtgcctcagaagaactcataa |
BBa_K2885000 | Protien G (ProG) | Coding | Sungho Ko | 555 | 2 | . . . gacgcgactaaaacttttaccgttaccgaa |
BBa_K2976006 | Anti-PD-L1 peptide | Coding | Jiatong Chen | 72 | 1 | . . . gtgcgccgcatcgaggacatgatgaaccag |
BBa_K380010 | Immunoglobulin G protease (IdeS) | Coding | Nina Schiller | 930 | . . . acagggcaagatagttggaatcagaccaat |