Difference between revisions of "Collections/BIOFAB"
(→BIOFAB) |
(→BIOFAB) |
||
Line 36: | Line 36: | ||
engineering. | engineering. | ||
</span></p> | </span></p> | ||
− | + | [[File:T--FSU--biofab-promoters-strength-plot.jpg|400px|center|BIOFAB Promoters Strength]] | |
− | + | <p>Fig1: Wider icons represent the variable regions within each element type. The labeled lines between elements are detailed as well. This picture and explanation of the BIOFAB Expression Operating Unit are obtained from source [1].</p> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<p><span></span></p> | <p><span></span></p> | ||
<p><span></span></p> | <p><span></span></p> | ||
<p><span></span></p> | <p><span></span></p> | ||
− | + | ===Design=== | |
<p><span>The Modular Promoter Library and the Randomized Promoter Library were | <p><span>The Modular Promoter Library and the Randomized Promoter Library were | ||
“assembled on medium-copy vectors derived from pFAB21... and pFAB216. Both pFAB217 | “assembled on medium-copy vectors derived from pFAB21... and pFAB216. Both pFAB217 | ||
Line 255: | Line 248: | ||
354–360 | 354–360 | ||
(2013). https://doi.org/10.1038/nmeth.2404 </span></p> | (2013). https://doi.org/10.1038/nmeth.2404 </span></p> | ||
− | |||
− | |||
===Modular Promoters with Strengths=== | ===Modular Promoters with Strengths=== |
Revision as of 15:56, 16 October 2020
BIOFAB
This is a brief description of the design, building, and testing of the modular and randomized promoter library from the “Precise and reliable gene expression via standard transcription and translation initiation elements” paper by Vivek K Mutalik, et al. If more information is needed, refer to the aforementioned paper.
The BIOFAB project consists of a study regarding the engineering of genetic elements that control transcription in E. Coli. The idea arises from the core principle of engineering “building a machine with parts,” which has been applied by the researchers responsible for the BIOFAB project, in synthetic biology [1] . The study describes the design, building and testing process of ~500 transcription and translation elements that are compatible with an “expression operating unit (EOU)” (fig1) [1]. Additionally, the BIOFAB project has recorded the strength/efficiency on translation and transcription of the aforementioned parts in different contexts. A reliable source that would provide information regarding the efficiency of transcription/translation elements would allow for one of the most common genetic engineering obstacles to be overcomed, which is “...the lack of standard parts that can be reused reliably in novel combinations...” [1]. This collection of parts provides information anyone can use in the mission to advance the knowledge of synthetic biology and genetic engineering.
Fig1: Wider icons represent the variable regions within each element type. The labeled lines between elements are detailed as well. This picture and explanation of the BIOFAB Expression Operating Unit are obtained from source [1].
Design
The Modular Promoter Library and the Randomized Promoter Library were “assembled on medium-copy vectors derived from pFAB21... and pFAB216. Both pFAB217 and pFAB216 were derived from the same backbone vector pBbA2k-RFP54” (in other words the plasmids used to design the modular and randomized promoter libraries were both derived from a backbone vector “pBbA2k-RFP54”). The medium-copy vectors were derived from the backbone vector by “replacing the Ptet promoter and the tetR gene with a defined sequence context including the Ptrc promoter and Bujard RBS (ribosomal sub-unit) region.” To design an expression operating unit (EOU) “an additional upstream region composed of three-frame stop codons, an intrinsic termi- nator56, a transcriptional pause site57 and an insulator region58 are introduced.” Design of the up and downstream terminators was needed to decrease the chance of interaction among the “EOU and the genetic context.” This way the functional parts can be separated from the EOU regions and the categorization of parts is more reliable.
-The Modular Promoter Library was “engineered by a combination of three modules originating from five promoters with different strengths”(125 total). The promoters were: “T7A1 promoter, Ptrc promoter, T5N25 promoter, the weaker NM535 series, and U56D46 version of the pRM promoter series.”
-The Randomized Promoter Library was created by randomizing the −10 motif (NTANNNTN) or the −35 motif (NTTNNNN) or both the −10 and −35 motifs of a strong Ptrc* constitutive promoter (TTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA)...
Building:
Modular Promoter Library: To build the MPL,
- Make “plasmid pFAB517 by amplifying the backbone vector pFAB217 (encoding the reporter GFP) using phosphorylated primers oFAB124 and oFAB125.”
- Purify the PCR-amplified vector backbone products “using Qiagen PCR purification kits, digested with DpnI, self-ligated using T4 DNA ligase enzyme and transformed into chemically competent BW25113 E. coli cells.”
- Then confirm the positive clones by sequencing (with soFAB1 and soFAB8 primers.
- Store clones as glycerol stocks.
- Prepare “plasmid minipreps.... and use them for “further MPL construction purposes.”
- The BsaI enzyme will then digest the Minipreps of these backbone vectors (37 °C, overnight (> 16 h)), then dephosphorylate, and gel-purify (Qiagen), which are used for the promoter library.
- “To prepare the promoter elements as inserts for building the MPL...125 forward and 125 reverse oligonucleotides (short DNA/RNA molecules)” were designed “such that they can be annealed together and their overhangs are compatible with the restriction-digested backbone vector pFAB517.”
Randomized Promoter Library:
- Amplify the −35, plasmid pFAB217 using phosphorylated primers oFAB176 and oFAB179. The forward primer oFAB176 retains the consensus −10 motif of the Ptrc promoter, and the reverserimer oFAB179 creates variants of the −35 motif (NTTNNNN).”
- “The phosphorylated primers oFAB178 and oFAB179 were used to randomize both the –10 motif and the –35 motif.”
- Purify the PCR products “using Qiagen PCR purification kit and digested with DpnI to remove the intact backbone vector.”
- “PCR products were then ligated using T4 DNA ligase, transformed into chemically competent BW25113 E. coli cells and grown overnight in selective LB agar medium (with kan) on three large QTray plates.”
- “The next day, about 2,000 colonies were picked from all three transformation plates (in total) and grown overnight (~16 h, at 37 °C, 900 r.p.m. on an Inforys shaker) in 500 μl MOPS EZ Rich +kan medium in 96–deep-well plates sealed with a breathable membrane.”
- “The following day, 250 μl of overnight culture was stored as a pre-sequencing glycerol stock (250 μl overnight culture + 250 μl of 30% sterile glycerol), and the remaining 150 μl of the overnight culture was subjected to the microplate end-point assay to measure growth (optical density, OD600 nm) and fluorescence (relative fluorescence units or RFU) at an excitation of 481 nm and emission of 507 nm for GFP in a multimode microplate reader-incubator-shaker Synergy-2 (BioTek Instruments).”
Testing.
Note that the testing for the Randomized and Modular promoter libraries is the same. The testing was done in the experiment through the following process:
- Store Assay Strains as Glycerol stocks in 96-deep-well plates (2ml).
- Grow “cultures in 2–ml–, 96–deep-well plates containing 400 μl of MOPS EZ Rich Medium (Teknova, cat. #M2105) with appropriate antibiotics, inoculating 3 μl from thawed glycerol stocks. Cultures were grown overnight (approximately 16h) in plates of 96 U-Shaped 2ml wells covered with sterile breathable sealing film at 37 °C with shaking at 900 r.p.m. on a Multitron shaker (Infors-HT).”
- “Overnight cultures were diluted 1:50 into a final volume of 150 μl of fresh medium with appropriate antibiotics in clear-bottom black plates and incubated in a multimode microplate reader-incubator-shaker Synergy-2 (BioTek Instruments).”
- The cultures were grown with rapid shaking for 6h and repeated measurements for optical density and fluorescence (RFU).
- “481-nm excitation and 507-nm emission for GFP; 560-nm excitation and 650-nm emission for RFP) were performed every 10 min.”
*Note: “All microplate kinetic assay experi-ments were repeated at least three times starting from inde-pendent overnight cultures.”
- For data acquisition Gen5 software for BioTek plate readers was used. The data acquired was analyzed using MATLAB software.
- Flow cytometer assays: 1:50 dilution of overnight cultures into 200 μl fresh medium “in 1-ml deep-well plates and grown for 2 h (to expo-nential phase with OD600 in the range of 0.3–0.5 in the microplate reader) at 37 °C with shaking at 900 r.p.m. on the Multitron shaker.”
- To encode the T7 promoter “the overnight cultures of BL21 (DE3) with plasmid libraries were diluted 1:50 in to a final volume of 200 μl fresh MOPS EZ Rich Medium with appropriate antibiotics and 0.4 mM IPTG (to induce T7 RNAP expression from wild-type lac promoter on chromosome) in 1-ml-deep–well plates and grown for 2 h (to exponential phase with OD600 in the range of 0.3–0.5 in the microplate reader) at 37 °C with shaking at 900 r.p.m. on a Multitron shaker.”
- “Cultures were diluted 1:2,000 in chilled and filtered PBS (pH 7.4) containing 500 μg/ml streptomycin in chilled 96-well clear plates (Costar) and immediately subjected to flow cytometer analysis.”
- “...A Guava easyCyte flow cytometer (EMD Millipore), equipped with microcapillary and autosampling capabilities, and paired dual blue (488-nm, 75-mW) and green (532-nm,40-mW) laser excitation with two customized filter options for emission detection of 510/20 for GFP and 610/20 for RFP,respectively” was used for the aforementioned analysis.
- “During the assay, the sample concentration was kept below 500 cells per μl, and samples were run on a high flow rate (1.18 μl/s) until 2,000 cells (with a range of 60–300 events per μl) had been collected within small forward- and side-scatter gates scripts15.”
- To calculate the fluorescence-per-cell values for the GOI, log-2 transformation followed by a mean-normalization was utilized in the experiment to analyze and compare fluorescence from “sequence-dis
- The fluorescence-per-cell values for each GOI construct were log2-transformed and then mean-normalized for comparative analysis of fluorescence from sequence-distinct GOI fusions.”
Firstly, an average “score” for part activity was calculated by “systematically assembling and testing all combinations of frequently used prokaryotic transcription and translation control elements,” additionally the activity variations of parts in new combinations was quantified [1].
Fig 1. The graph shows the GFP expression relative to each promoter from the Modular promoter and randomized library.
Sources:
Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404
Modular Promoters with Strengths
Parts Registry Name | BIOFAB ID | Strength | |
BBa_M36303 | apFAB46 | 897.636 | |
BBa_K2832101 | apFAB70 | 866.671 | |
BBa_K2832102 | apFAB71 | 866.296 | |
BBa_K2832103 | apFAB61 | 857.927 | |
BBa_K2832104 | apFAB80 | 787.199 | |
BBa_K2832105 | apFAB45 | 785.309 | |
BBa_K2832106 | apFAB47 | 782.004 | |
BBa_K2832107 | apFAB31 | 781.826 | |
BBa_K2832108 | apFAB55 | 768.983 | |
BBa_K2832109 | apFAB68 | 766.301 | |
BBa_K2832110 | apFAB101 | 757.959 | |
BBa_K2832111 | apFAB96 | 748.822 | |
BBa_K2832112 | apFAB56 | 743.476 | |
BBa_K2832113 | apFAB81 | 742.631 | |
BBa_K2832114 | apFAB92 | 742.334 | |
BBa_K2832115 | apFAB72 | 737.59 | |
BBa_K2832116 | apFAB100 | 736.966 | |
BBa_K2832117 | apFAB76 | 736.51 | |
BBa_K2832118 | apFAB30 | 731.463 | |
BBa_K2832119 | apFAB79 | 728.654 | |
BBa_K2832120 | apFAB75 | 717.72 | |
BBa_K2832121 | apFAB50 | 707.166 | |
BBa_K2832122 | apFAB93 | 706.957 | |
BBa_K2832123 | apFAB60 | 700.31 | |
BBa_K2832124 | apFAB54 | 690.839 | |
BBa_K2832125 | apFAB62 | 687.948 | |
BBa_K2832126 | apFAB42 | 685.34 | |
BBa_K2832127 | apFAB53 | 682.888 | |
BBa_K2832128 | apFAB85 | 674.421 | |
BBa_K2832129 | apFAB65 | 670.065 | |
BBa_K2832130 | apFAB52 | 666.998 | |
BBa_K2832131 | apFAB67 | 649.993 | |
BBa_K2832132 | apFAB32 | 645.519 | |
BBa_K2832133 | apFAB57 | 637.488 | |
BBa_K2832134 | apFAB39 | 594.378 | |
BBa_K2832135 | apFAB115 | 573.792 | |
BBa_K2832136 | apFAB29 | 565.946 | |
BBa_K2832137 | apFAB77 | 555.565 | |
BBa_K2832138 | apFAB36 | 547.956 | |
BBa_K2832139 | apFAB44 | 540.856 | |
BBa_K2832140 | apFAB102 | 534.826 | |
BBa_K2832141 | apFAB37 | 530.604 | |
BBa_K2832142 | apFAB41 | 523.35 | |
BBa_K2832143 | apFAB63 | 518.502 | |
BBa_K2832144 | apFAB140 | 508.942 | |
BBa_K2832145 | apFAB64 | 508.117 | |
BBa_K2832146 | apFAB40 | 488.364 | |
BBa_K2832147 | apFAB97 | 477.744 | |
BBa_K2832148 | apFAB78 | 476.327 | |
BBa_K2832149 | apFAB69 | 474.513 | |
BBa_K2832150 | apFAB103 | 459.253 | |
BBa_K2832151 | apFAB73 | 456.758 | |
BBa_K2832152 | apFAB66 | 439.276 | |
BBa_K2832153 | apFAB126 | 433.829 | |
BBa_K2832154 | apFAB95 | 425.407 | |
BBa_K2832155 | apFAB151 | 422.838 | |
BBa_K2832156 | apFAB48 | 411.861 | |
BBa_K2832157 | apFAB82 | 389.529 | |
BBa_K2832158 | apFAB141 | 376.932 | |
BBa_K2832159 | apFAB150 | 366.498 | |
BBa_K2832160 | apFAB125 | 363.199 | |
BBa_K2832161 | apFAB33 | 340.476 | |
BBa_K2832162 | apFAB121 | 328.946 | |
BBa_K2832163 | apFAB111 | 327.288 | |
BBa_K2832164 | apFAB58 | 287.687 | |
BBa_K2832165 | apFAB94 | 279.605 | |
BBa_K2832166 | apFAB145 | 271.14 | |
BBa_K2832167 | apFAB118 | 267.819 | BBa_K2832168 | apFAB106 | 256.824 |
BBa_K2832169 | apFAB110 | 254.676 | |
BBa_K2832170 | apFAB105 | 243.758 | |
BBa_K2832171 | apFAB38 | 239.875 | |
BBa_K2832172 | apFAB89 | 223.766 | |
BBa_K2832173 | apFAB142 | 214.923 | |
BBa_K2832174 | apFAB130 | 182.202 | |
BBa_K2832175 | apFAB131 | 167.803 | |
BBa_K2832176 | apFAB143 | 157.015 | |
BBa_K2832177 | apFAB87 | 145.215 | |
BBa_K2832178 | apFAB104 | 126.832 | |
BBa_K2832179 | apFAB98 | 120.521 | |
BBa_K2832180 | apFAB51 | 103.187 | |
BBa_K2832181 | apFAB49 | 93.9231 | |
BBa_K2832182 | apFAB120 | 81.7515 | |
BBa_K2832183 | apFAB83 | 79.3039 | |
BBa_K2832184 | apFAB117 | 62.9585 | |
BBa_K2832185 | apFAB129 | 60.7537 | |
BBa_K2832186 | apFAB146 | 58.9582 | |
BBa_K2832187 | apFAB59 | 58.498 | |
BBa_K2832188 | apFAB127 | 48.3838 | |
BBa_K2832189 | apFAB88 | 48.354 | |
BBa_K2832190 | apFAB86 | 44.6204 | |
BBa_K2832191 | apFAB74 | 44.6094 | |
BBa_K2832192 | apFAB152 | 40.7219 | |
BBa_K2832193 | apFAB122 | 36.8209 | |
BBa_K2832194 | apFAB128 | 26.6541 | |
BBa_K2832195 | apFAB99 | 26.5471 | |
BBa_K2832196 | apFAB119 | 20.866 | |
BBa_K2832197 | apFAB112 | 17.3114 | |
BBa_K2832198 | apFAB34 | 14.6339 | |
BBa_K2832199 | apFAB147 | 13.3236 | |
BBa_K2832200 | apFAB144 | 13.0792 | |
BBa_K2832201 | apFAB35 | 12.6234 | |
BBa_K2832202 | apFAB107 | 11.4242 | |
BBa_K2832203 | apFAB123 | 11.2076 | |
BBa_K2832204 | apFAB137 | 7.09512 | |
BBa_K2832205 | apFAB113 | 5.32229 | |
BBa_K2832206 | apFAB84 | 4.73181 | |
BBa_K2832207 | apFAB148 | 4.01421 | |
BBa_K2832208 | apFAB108 | 3.64128 | |
BBa_K2832209 | apFAB114 | 3.35398 | |
BBa_K2832210 | apFAB136 | 3.19915 | |
BBa_K2832211 | apFAB124 | 2.64681 | |
BBa_K2832212 | apFAB149 | 2.52982 | |
BBa_K2832213 | apFAB134 | 2.52663 | |
BBa_K2832214 | apFAB138 | 1.64153 | |
BBa_K2832215 | apFAB43 | 1.0947 | |
BBa_K2832216 | apFAB133 | 0.84608 | |
BBa_K2832217 | apFAB139 | 0.681873 | |
BBa_K2832218 | apFAB91 | 0.42395 | |
BBa_K2832219 | apFAB90 | 0.378777 |
Random Promoters with Strengths
Parts Registry Name | BIOFAB ID | Strength |
---|---|---|
BBa_J97008 | apFAB342 | 740.35 |
BBa_K3702000 | apFAB347 | 738.40 |
BBa_K3702001 | apFAB345 | 714.53 |
BBa_K3702002 | apFAB341 | 668.45 |
BBa_K3702003 | apFAB317 | 654.56 |
BBa_K3702004 | apFAB338 | 615.44 |
BBa_K3702005 | apFAB323 | 611.20 |
BBa_K3702006 | apFAB339 | 580.23 |
BBa_K3702007 | apFAB321 | 557.04 |
BBa_K3702008 | apFAB340 | 538.51 |
BBa_K3702009 | apFAB322 | 516.83 |
BBa_K3702010 | apFAB346 | 466.88 |
BBa_K3702011 | apFAB303 | 345.31 |
BBa_K3702012 | apFAB302 | 342.55 |
BBa_K3702013 | apFAB297 | 339.75 |
BBa_K3702014 | apFAB301 | 338.31 |
BBa_K3702015 | apFAB298 | 327.52 |
BBa_K3702016 | apFAB306 | 307.03 |
BBa_K3702017 | apFAB307 | 283.99 |
BBa_K3702018 | apFAB296 | 277.56 |
BBa_K3702019 | apFAB308 | 269.83 |
BBa_K3702020 | apFAB295 | 252.47 |
BBa_K3702021 | apFAB300 | 246.62 |
BBa_K3702022 | apFAB299 | 203.95 |
BBa_K3702023 | apFAB309 | 199.95 |
BBa_K3702024 | apFAB305 | 164.05 |
BBa_K3702025 | apFAB313 | 160.29 |
BBa_K3702026 | apFAB310 | 156.73 |
BBa_K3702027 | apFAB311 | 155.52 |
BBa_K3702028 | apFAB279 | 145.82 |
BBa_K3702029 | apFAB314 | 141.99 |
BBa_K3702030 | apFAB281 | 139.88 |
BBa_K3702031 | apFAB276 | 138.28 |
BBa_K3702032 | apFAB312 | 135.53 |
BBa_K3702033 | apFAB273 | 128.84 |
BBa_K3702034 | apFAB316 | 123.38 |
BBa_K3702035 | apFAB282 | 105.12 |
BBa_K3702036 | apFAB260 | 99.29 |
BBa_K3702037 | apFAB293 | 98.98 |
BBa_K3702038 | apFAB259 | 95.97 |
BBa_K3702039 | apFAB284 | 77.82 |
BBa_K3702040 | apFAB285 | 76.92 |
BBa_K3702041 | apFAB286 | 76.12 |
BBa_K3702042 | apFAB257 | 75.39 |
BBa_K3702043 | apFAB267 | 74.39 |
BBa_K3702044 | apFAB263 | 70.05 |
BBa_K3702045 | apFAB262 | 65.83 |
BBa_K3702046 | apFAB265 | 63.55 |
BBa_K3702047 | apFAB271 | 59.33 |
BBa_K3702048 | apFAB278 | 58.41 |
BBa_K3702049 | apFAB241 | 57.40 |
BBa_K3702050 | apFAB280 | 57.40 |
BBa_K3702051 | apFAB254 | 57.29 |
BBa_K3702052 | apFAB266 | 56.78 |
BBa_K3702053 | apFAB270 | 55.67 |
BBa_K3702054 | apFAB287 | 52.53 |
BBa_K3702055 | apFAB256 | 49.71 |
BBa_K3702056 | apFAB253 | 49.10 |
BBa_K3702057 | apFAB264 | 48.80 |
BBa_K3702058 | apFAB337 | 48.57 |
BBa_K3702059 | apFAB261 | 47.13 |
BBa_K3702060 | apFAB272 | 45.89 |
BBa_K3702061 | apFAB274 | 44.90 |
BBa_K3702062 | apFAB258 | 39.55 |
BBa_K3702063 | apFAB255 | 38.32 |
BBa_K3702064 | apFAB268 | 38.05 |
BBa_K3702065 | apFAB333 | 34.24 |
BBa_K3702066 | apFAB326 | 33.51 |
BBa_K3702067 | apFAB343 | 33.50 |
BBa_K3702068 | apFAB329 | 33.21 |
BBa_K3702069 | apFAB332 | 32.73 |
BBa_K3702070 | apFAB252 | 32.49 |
BBa_K3702071 | apFAB251 | 30.07 |
BBa_K3702072 | apFAB226 | 29.25 |
BBa_K3702073 | apFAB315 | 25.64 |
BBa_K3702074 | apFAB335 | 21.55 |
BBa_K3702075 | apFAB334 | 21.08 |
BBa_K3702076 | apFAB319 | 20.39 |
BBa_K3702077 | apFAB229 | 15.31 |
BBa_K3702078 | apFAB228 | 14.36 |
BBa_K3702079 | apFAB225 | 13.71 |
BBa_K3702080 | apFAB224 | 13.10 |
BBa_K3702081 | apFAB324 | 12.77 |
BBa_K3702082 | apFAB230 | 12.69 |
BBa_K3702083 | apFAB318 | 12.62 |
BBa_K3702084 | apFAB331 | 11.14 |
BBa_K3702085 | apFAB304 | 10.75 |
BBa_K3702086 | apFAB231 | 10.58 |
BBa_K3702087 | apFAB227 | 9.46 |
BBa_K3702088 | apFAB209 | 8.05 |
BBa_K3702089 | apFAB202 | 5.83 |
BBa_K3702090 | apFAB212 | 5.57 |
BBa_K3702091 | apFAB211 | 5.30 |
BBa_K3702092 | apFAB221 | 4.87 |
BBa_K3702093 | apFAB205 | 4.80 |
BBa_K3702094 | apFAB201 | 4.75 |
BBa_K3702095 | apFAB193 | 4.48 |
BBa_K3702096 | apFAB203 | 4.46 |
BBa_K3702097 | apFAB200 | 4.41 |
BBa_K3702098 | apFAB207 | 4.26 |
BBa_K3702099 | apFAB206 | 4.20 |
BBa_K3702100 | apFAB194 | 4.17 |
BBa_K3702101 | apFAB208 | 4.17 |
BBa_K3702102 | apFAB181 | 4.00 |
BBa_K3702103 | apFAB204 | 3.85 |
BBa_K3702104 | apFAB190 | 3.75 |
BBa_K3702105 | apFAB189 | 3.69 |
BBa_K3702106 | apFAB184 | 3.62 |
BBa_K3702107 | apFAB215 | 3.44 |
BBa_K3702108 | apFAB168 | 3.33 |
BBa_K3702109 | apFAB197 | 3.28 |
BBa_K3702110 | apFAB199 | 3.27 |
BBa_K3702111 | apFAB216 | 3.09 |
BBa_K3702112 | apFAB180 | 2.98 |
BBa_K3702113 | apFAB187 | 2.97 |
BBa_K3702114 | apFAB182 | 2.94 |
BBa_K3702115 | apFAB186 | 2.92 |
BBa_K3702116 | apFAB183 | 2.76 |
BBa_K3702117 | apFAB195 | 2.73 |
BBa_K3702118 | apFAB167 | 2.68 |
BBa_K3702119 | apFAB177 | 2.67 |
BBa_K3702120 | apFAB192 | 2.57 |
BBa_K3702121 | apFAB220 | 2.55 |
BBa_K3702122 | apFAB161 | 2.54 |
BBa_K3702123 | apFAB160 | 2.52 |
BBa_K3702124 | apFAB162 | 2.51 |
BBa_K3702125 | apFAB159 | 2.50 |
BBa_K3702126 | apFAB164 | 2.50 |
BBa_K3702127 | apFAB166 | 2.49 |
BBa_K3702128 | apFAB157 | 2.48 |
BBa_K3702129 | apFAB217 | 2.48 |
BBa_K3702130 | apFAB156 | 2.46 |
BBa_K3702131 | apFAB213 | 2.33 |
BBa_K3702132 | apFAB325 | 2.24 |
BBa_K3702133 | apFAB188 | 1.93 |
BBa_K3702134 | apFAB210 | 1.80 |
BBa_K3702135 | apFAB327 | 0.75 |
BBa_K3702136 | apFAB294 | 0.21 |
Modular Promoter Automated Listing by the Parts Registry
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K2832100 | BIOFAB Modular Promoter apFAB46 | Regulatory | BIOFAB | 47 | 1 | . . . cgcatctttttgtacctataatagattcat |
BBa_K2832101 | BIOFAB Modular Promoter apFAB70 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832102 | BIOFAB Modular Promoter apFAB71 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832103 | BIOFAB Modular Promoter apFAB61 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832104 | BIOFAB Modular Promoter apFAB80 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832105 | BIOFAB Modular Promoter apFAB45 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832106 | BIOFAB Modular Promoter apFAB47 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832107 | BIOFAB modular Promoter apFAB31 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832108 | BIOFAB modular Promoter apFAB55 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832109 | BIOFAB modular Promoter apFAB68 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832110 | BIOFAB modular Promoter apFAB101 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832111 | BIOFAB Modular Promoter apFAB96 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832112 | BIOFAB Modular Promoter apFAB56 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832113 | BIOFAB Modular Promoter apFAB81 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832114 | BIOFAB Modular Promoter apFAB92 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832115 | BIOFAB Modular Promoter apFAB72 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832116 | BIOFAB Modular Promoter apFAB100 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832117 | BIOFAB Modular Promoter apFAB76 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832118 | BIOFAB Modular Promoter apFAB30 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832119 | BIOFAB Modular Promoter apFAB79 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832120 | BIOFAB Modular Promoter apFAB75 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832121 | BIOFAB Modular Promoter apFAB50 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832122 | BIOFAB Modular Promoter apFAB93 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832123 | BIOFAB Modular Promoter apFAB60 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832124 | BIOFAB Modular Promoter apFAB54 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832125 | BIOFAB Modular Promoter apFAB62 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832126 | BIOFAB Modular Promoter apFAB42 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832127 | BIOFAB Modular Promoter apFAB53 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832128 | BIOFAB Modular Promoter apFAB85 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832129 | BIOFAB Modular Promoter apFAB65 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832130 | BIOFAB Modular Promoter apFAB52 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832131 | BIOFAB Modular Promoter apFAB67 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832132 | BIOFAB Modular Promoter apFAB32 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832133 | BIOFAB Modular Promoter apFAB57 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832134 | BIOFAB Modular Promoter apFAB39 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832135 | BIOFAB Modular Promoter apFAB115 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832136 | BIOFAB Modular Promoter apFAB29 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832137 | BIOFAB Modular Promoter apFAB77 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832138 | BIOFAB Modular Promoter apFAB36 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832139 | BIOFAB Modular Promoter apFAB44 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832140 | BIOFAB Modular Promoter apFAB102 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832141 | BIOFAB Modular Promoter apFAB37 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832142 | BIOFAB Modular Promoter apFAB41 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832143 | BIOFAB Modular Promoter apFAB63 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832144 | BIOFAB Modular Promoter apFAB140 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832145 | bIOFAB Modular Promoter apFAB64 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832146 | BIOFAB Modular Promoter apFAB40 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832147 | BIOFAB Modular Promoter apFAB97 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832148 | BIOFAB modular Promoter apFAB78 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832149 | BIOFAB Modular Promoter apFAB69 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832150 | BIOFAB Modular Promoter apFAB103 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832151 | BIOFAB Modular Promoter apFAB73 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832152 | BIOFAB Modular Promoter apFAB66 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832153 | BIOFAB Modular Promoter apFAB126 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832154 | BIOFAB Modular Promoter apFAB95 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832155 | BIOFAB Modular Promoter apFAB151 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832156 | BIOFAB Modular Promoter apFAB48 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832157 | BIOFAB Modular Promoter apFAB82 | Regulatory | BIOFAB | 49 | 1 | . . . aagtctaacctataggcataattatttcat |
BBa_K2832158 | BIOFAB Modular Promoter apFAB141 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832159 | BIOFAB Modular Promoter apFAB150 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832160 | BIOFAB Modular Promoter apFAB125 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832161 | BIOFAB Modular Promoter apFAB33 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832162 | BIOFAB Modular Promoter apFAB121 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832163 | BIOFAB modular Promoter apFAB111 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832164 | BIOFAB modular Promoter apFAB58 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832165 | BIOFAB modular Promoter apFAB94 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832166 | BIOFAB modular Promoter apFAB145 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832167 | BIOFAB Modular Promoter apFAB118 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832168 | BIOFAB Modular Promoter apFAB106 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832169 | BIOFAB Modular Promoter apFAB110 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832170 | BIOFAB Modular Promoter apFAB105 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832171 | BIOFAB Modular Promoter apFAB38 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832172 | BIOFAB Modular Promoter apFAB89 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832173 | BIOFAB Modular Promoter apFAB142 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832174 | BIOFAB Modular Promoter apFAB130 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832175 | BIOFAB Modular Promoter apFAB131 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832176 | BIOFAB Modular Promoter apFAB143 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832177 | BIOFAB Modular Promoter apFAB87 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832178 | BIOFAB Modular Promoter apFAB104 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832179 | BIOFAB Modular Promoter apFAB98 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832180 | BIOFAB Modular Promoter apFAB51 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832181 | BIOFAB Modular Promoter apFAB49 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832182 | BIOFAB Modular Promoter apFAB120 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832183 | BIOFAB Modular Promoter apFAB83 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832184 | BIOFAB Modular Promoter apFAB117 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832185 | BIOFAB Modular Promoter apFAB129 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832186 | BIOFAB Modular Promoter apFAB146 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832187 | BIOFAB Modular Promoter apFAB59 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832188 | BIOFAB Modular Promoter apFAB127 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832189 | BIOFAB Modular Promoter apFAB88 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832190 | BIOFAB Modular Promoter apFAB86 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832191 | BIOFAB Modular Promoter apFAB74 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832192 | BIOFAB Modular Promoter apFAB152 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832193 | BIOFAB Modular Promoter apFAB122 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832194 | BIOFAB Modular Promoter apFAB128 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832195 | BIOFAB Modular Promoter apFAB99 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832196 | BIOFAB Modular Promoter apFAB119 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832197 | BIOFAB Modular Promoter apFAB112 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832198 | BIOFAB Modular Promoter apFAB34 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832199 | BIOFAB Modular Promoter apFAB147 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832200 | BIOFAB Modular Promoter apFAB144 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832201 | BIOFAB Modular Promoter apFAB35 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832202 | BIOFAB modular Promoter apFAB107 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832203 | BIOFAB modular Promoter apFAB123 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832204 | BIOFAB Modular Promoter apFAB137 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832205 | BIOFAB Modular Promoter apFAB113 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832206 | BIOFAB Modular Promoter apFAB84 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832207 | BIOFAB Modular Promoter apFAB148 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832208 | BIOFAB Modular Promoter apFAB108 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832209 | BIOFAB Modular Promoter apFAB114 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832210 | BIOFAB Modular Promoter apFAB136 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832211 | BIOFAB Modular Promoter apFAB124 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832212 | BIOFAB Modular Promoter apFAB149 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832213 | BIOFAB Modular Promoter apFAB134 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832214 | BIOFAB Modular Promoter apFAB138 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832215 | BIOFAB Modular Promoter apFAB43 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832216 | BIOFAB Modular Promoter apFAB133 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832217 | BIOFAB Modular Promoter apFAB139 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832218 | BIOFAB Modular Promoter apFAB91 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832219 | BIOFAB Modular Promoter apFAB90 | Regulatory | BIOFAB | 48 | 1 | . . . caggaaaatttttctgtataatgtgtggat |
Random Promoter Automated Listing by the Parts Registry
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_J97008 | BIOFAB Random Promoter apFAB342 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataaaatttgtgga |
BBa_K3702000 | BIOFAB Random Promoter apFAB347 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaatatgtgtgga |
BBa_K3702001 | BIOFAB Random Promoter apFAB345 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagagtatgtgga |
BBa_K3702002 | BIOFAB Random Promoter apFAB341 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatatgtgtgga |
BBa_K3702003 | BIOFAB Random Promoter apFAB317 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702004 | BIOFAB Random Promoter apFAB338 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaggatgtgtgga |
BBa_K3702005 | BIOFAB Random Promoter apFAB323 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702006 | BIOFAB Random Promoter apFAB339 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatttatgtgga |
BBa_K3702007 | BIOFAB Random Promoter apFAB321 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaacttatgtgga |
BBa_K3702008 | BIOFAB Random Promoter apFAB340 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtatgtgtgga |
BBa_K3702009 | BIOFAB Random Promoter apFAB322 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702010 | BIOFAB Random Promoter apFAB346 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatgtttgtgga |
BBa_K3702011 | BIOFAB Random Promoter apFAB303 | Regulatory | BIOFAB | 35 | -1 | . . . tcttaatcatcggctcgtataatgtgtgga |
BBa_K3702012 | BIOFAB Random Promoter apFAB302 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702013 | BIOFAB Random Promoter apFAB297 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702014 | BIOFAB Random Promoter apFAB301 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702015 | BIOFAB Random Promoter apFAB298 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702016 | BIOFAB Random Promoter apFAB306 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtgtttgtgga |
BBa_K3702017 | BIOFAB Random Promoter apFAB307 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatcgtttgtgga |
BBa_K3702018 | BIOFAB Random Promoter apFAB296 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702019 | BIOFAB Random Promoter apFAB308 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaggttatgtgga |
BBa_K3702020 | BIOFAB Random Promoter apFAB295 | Regulatory | BIOFAB | 35 | -1 | . . . tcttaatcatcggctcgtataatgtgtgga |
BBa_K3702021 | BIOFAB Random Promoter apFAB300 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702022 | BIOFAB Random Promoter apFAB299 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702023 | BIOFAB Random Promoter apFAB309 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtgtctgtgga |
BBa_K3702024 | BIOFAB Random Promoter apFAB305 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagggtttgtgga |
BBa_K3702025 | BIOFAB Random Promoter apFAB313 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagggtgtgtgga |
BBa_K3702026 | BIOFAB Random Promoter apFAB310 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctatcttctgtgga |
BBa_K3702027 | BIOFAB Random Promoter apFAB311 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaggttgtgtgga |
BBa_K3702028 | BIOFAB Random Promoter apFAB279 | Regulatory | BIOFAB | 35 | -1 | . . . ctttaatcatcggctcgtataatgtgtgga |
BBa_K3702029 | BIOFAB Random Promoter apFAB314 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaagttgtgtgga |
BBa_K3702030 | BIOFAB Random Promoter apFAB281 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702031 | BIOFAB Random Promoter apFAB276 | Regulatory | BIOFAB | 35 | -1 | . . . tattaatcatcggctcgtataatgtgtgga |
BBa_K3702032 | BIOFAB Random Promoter apFAB312 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagtgtttgtgga |
BBa_K3702033 | BIOFAB Random Promoter apFAB273 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702034 | BIOFAB Random Promoter apFAB316 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatagtatgtgga |
BBa_K3702035 | BIOFAB Random Promoter apFAB282 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702036 | BIOFAB Random Promoter apFAB260 | Regulatory | BIOFAB | 35 | -1 | . . . tgttaatcatcggctcgtataatgtgtgga |
BBa_K3702037 | BIOFAB Random Promoter apFAB293 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaggttgtgtgga |
BBa_K3702038 | BIOFAB Random Promoter apFAB259 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702039 | BIOFAB Random Promoter apFAB284 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataagttttgtgga |
BBa_K3702040 | BIOFAB Random Promoter apFAB285 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagcctctgtgga |
BBa_K3702041 | BIOFAB Random Promoter apFAB286 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagtttttgtgga |
BBa_K3702042 | BIOFAB Random Promoter apFAB257 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702043 | BIOFAB Random Promoter apFAB267 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagggtctgtgga |
BBa_K3702044 | BIOFAB Random Promoter apFAB263 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702045 | BIOFAB Random Promoter apFAB262 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702046 | BIOFAB Random Promoter apFAB265 | Regulatory | BIOFAB | 35 | -1 | . . . tattaatcatcggctcatccattatgtgga |
BBa_K3702047 | BIOFAB Random Promoter apFAB271 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagcgtgtgtgga |
BBa_K3702048 | BIOFAB Random Promoter apFAB278 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702049 | BIOFAB Random Promoter apFAB241 | Regulatory | BIOFAB | 35 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702050 | BIOFAB Random Promoter apFAB280 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702051 | BIOFAB Random Promoter apFAB254 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702052 | BIOFAB Random Promoter apFAB266 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggctatgtgga |
BBa_K3702053 | BIOFAB Random Promoter apFAB270 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcataaagtgtgtgga |
BBa_K3702054 | BIOFAB Random Promoter apFAB287 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagggtttgtgga |
BBa_K3702055 | BIOFAB Random Promoter apFAB256 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702056 | BIOFAB Random Promoter apFAB253 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702057 | BIOFAB Random Promoter apFAB264 | Regulatory | BIOFAB | 35 | -1 | . . . ctttaatcatcggctcgtataatgtgtgga |
BBa_K3702058 | BIOFAB Random Promoter apFAB337 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702059 | BIOFAB Random Promoter apFAB261 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702060 | BIOFAB Random Promoter apFAB272 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcgtagagtttgtgga |
BBa_K3702061 | BIOFAB Random Promoter apFAB274 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702062 | BIOFAB Random Promoter apFAB258 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagtttctgtgga |
BBa_K3702063 | BIOFAB Random Promoter apFAB255 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcgtataatgtgtgga |
BBa_K3702064 | BIOFAB Random Promoter apFAB268 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagcgtgtgtgga |
BBa_K3702065 | BIOFAB Random Promoter apFAB333 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702066 | BIOFAB Random Promoter apFAB326 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702067 | BIOFAB Random Promoter apFAB343 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagcgtctgtgga |
BBa_K3702068 | BIOFAB Random Promoter apFAB329 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtatcatatgtgga |
BBa_K3702069 | BIOFAB Random Promoter apFAB332 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702070 | BIOFAB Random Promoter apFAB252 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatgctttgtgga |
BBa_K3702071 | BIOFAB Random Promoter apFAB251 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaggttctgtgga |
BBa_K3702072 | BIOFAB Random Promoter apFAB226 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatctgtgga |
BBa_K3702073 | BIOFAB Random Promoter apFAB315 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702074 | BIOFAB Random Promoter apFAB335 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702075 | BIOFAB Random Promoter apFAB334 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702076 | BIOFAB Random Promoter apFAB319 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702077 | BIOFAB Random Promoter apFAB229 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702078 | BIOFAB Random Promoter apFAB228 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702079 | BIOFAB Random Promoter apFAB225 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctataatttgtgga |
BBa_K3702080 | BIOFAB Random Promoter apFAB224 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtagagtgtgtgga |
BBa_K3702081 | BIOFAB Random Promoter apFAB324 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggctttgtgga |
BBa_K3702082 | BIOFAB Random Promoter apFAB230 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702083 | BIOFAB Random Promoter apFAB318 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702084 | BIOFAB Random Promoter apFAB331 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcggagactttgtgga |
BBa_K3702085 | BIOFAB Random Promoter apFAB304 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702086 | BIOFAB Random Promoter apFAB231 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702087 | BIOFAB Random Promoter apFAB227 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702088 | BIOFAB Random Promoter apFAB209 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702089 | BIOFAB Random Promoter apFAB202 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatctgtgga |
BBa_K3702090 | BIOFAB Random Promoter apFAB212 | Regulatory | BIOFAB | 35 | -1 | . . . ttttaatcatcggctcgtataatgtgtgga |
BBa_K3702091 | BIOFAB Random Promoter apFAB211 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702092 | BIOFAB Random Promoter apFAB221 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagactgtgtgga |
BBa_K3702093 | BIOFAB Random Promoter apFAB205 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtattatatgtgga |
BBa_K3702094 | BIOFAB Random Promoter apFAB201 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcctatagtgtgtgga |
BBa_K3702095 | BIOFAB Random Promoter apFAB193 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702096 | BIOFAB Random Promoter apFAB203 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtagtctgtgtgga |
BBa_K3702097 | BIOFAB Random Promoter apFAB200 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttagggtttgtgga |
BBa_K3702098 | BIOFAB Random Promoter apFAB207 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcatatactttgtgga |
BBa_K3702099 | BIOFAB Random Promoter apFAB206 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtaccctttgtgga |
BBa_K3702101 | BIOFAB Random Promoter apFAB208 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702102 | BIOFAB Random Promoter apFAB181 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtaaactgtgtgga |
BBa_K3702103 | BIOFAB Random Promoter apFAB204 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagtgtatgtgga |
BBa_K3702104 | BIOFAB Random Promoter apFAB190 | Regulatory | BIOFAB | 35 | -1 | . . . cgttaatcatcggctcgtataatgtgtgga |
BBa_K3702105 | BIOFAB Random Promoter apFAB189 | Regulatory | BIOFAB | 35 | -1 | . . . ccttaatcatcggctcgtataatgtgtgga |
BBa_K3702106 | BIOFAB Random Promoter apFAB184 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtacgatgtgtgga |
BBa_K3702107 | BIOFAB Random Promoter apFAB215 | Regulatory | BIOFAB | 35 | -1 | . . . ggttaatcatcggctcgtataatgtgtgga |
BBa_K3702108 | BIOFAB Random Promoter apFAB168 | Regulatory | BIOFAB | 35 | -1 | . . . cctaatcatccggctcgtataatgtgtgga |
BBa_K3702109 | BIOFAB Random Promoter apFAB197 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggttttgtgga |
BBa_K3702110 | BIOFAB Random Promoter apFAB199 | Regulatory | BIOFAB | 35 | -1 | . . . attaatcatccggctcgtagtgtgtgtgga |
BBa_K3702111 | BIOFAB Random Promoter apFAB216 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702112 | BIOFAB Random Promoter apFAB180 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtattgtatgtgga |
BBa_K3702113 | BIOFAB Random Promoter apFAB187 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtatagtctgtgga |
BBa_K3702114 | BIOFAB Random Promoter apFAB182 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcttaacttgtgtgga |
BBa_K3702115 | BIOFAB Random Promoter apFAB186 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtatgttctgtgga |
BBa_K3702116 | BIOFAB Random Promoter apFAB183 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaggttatgtgga |
BBa_K3702117 | BIOFAB Random Promoter apFAB195 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcggaaagaatgtgga |
BBa_K3702118 | BIOFAB Random Promoter apFAB167 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataaaatttgtgga |
BBa_K3702119 | BIOFAB Random Promoter apFAB177 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcaggtgtaatgtgga |
BBa_K3702120 | BIOFAB Random Promoter apFAB192 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702121 | BIOFAB Random Promoter apFAB220 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcatatggtctgtgga |
BBa_K3702122 | BIOFAB Random Promoter apFAB161 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcttagagtatgtgga |
BBa_K3702123 | BIOFAB Random Promoter apFAB160 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcttatagtttgtgga |
BBa_K3702124 | BIOFAB Random Promoter apFAB162 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtctgtgtgga |
BBa_K3702125 | BIOFAB Random Promoter apFAB159 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctagcatgtgtgga |
BBa_K3702126 | BIOFAB Random Promoter apFAB164 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaccgtttgtgga |
BBa_K3702127 | BIOFAB Random Promoter apFAB166 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatctggctcatagtttatgtgga |
BBa_K3702128 | BIOFAB Random Promoter apFAB157 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatattttttgtgga |
BBa_K3702129 | BIOFAB Random Promoter apFAB217 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcctagggtttgtgga |
BBa_K3702130 | BIOFAB Random Promoter apFAB156 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctagtttgtgtgga |
BBa_K3702131 | BIOFAB Random Promoter apFAB213 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702132 | BIOFAB Random Promoter apFAB325 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatatccggctcgtagcgtctgtgga |
BBa_K3702133 | BIOFAB Random Promoter apFAB188 | Regulatory | BIOFAB | 35 | -1 | . . . ccttaatcatcggctcgtataatgtgtgga |
BBa_K3702134 | BIOFAB Random Promoter apFAB210 | Regulatory | BIOFAB | 35 | -1 | . . . cgttaatcatcggctcgtataatgtgtgga |
BBa_K3702135 | BIOFAB Random Promoter apFAB327 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcctactctgtgtgga |
BBa_K3702136 | BIOFAB Random Promoter apFAB294 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcataaaatttgtgga |
Terminator Automated Listing by the Parts Registry
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K3702161 | BIOFAB Terminator apFAB376 | Terminator | BIOFAB | 34 | -1 | . . . aaaaaccccgcttcggcggggttttttcgc |
BBa_K3702173 | BIOFAB Terminator apFAB388 | Terminator | BIOFAB | 39 | -1 | . . . ccccgcccctgacagggcggggtttttttt |
BBa_K3702137 | BIOFAB Terminator apFAB352 | Terminator | BIOFAB | 86 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702138 | BIOFAB Terminator apFAB353 | Terminator | BIOFAB | 50 | -1 | . . . atatttcgattgcatgtgcaattttttgca |
BBa_K3702139 | BIOFAB Terminator apFAB354 | Terminator | BIOFAB | 33 | -1 | . . . tcgcaaaaaaccccgctggggttttttcgc |
BBa_K3702140 | BIOFAB Terminator apFAB355 | Terminator | BIOFAB | 80 | -1 | . . . tgtctattatccctaagcccattttttgca |
BBa_K3702141 | BIOFAB Terminator apFAB356 | Terminator | BIOFAB | 121 | -1 | . . . tgcactaagcacataattgctcacagccaa |
BBa_K3702142 | BIOFAB Terminator apFAB357 | Terminator | BIOFAB | 52 | -1 | . . . gatacccagcccgcctaatcaatgcaaaca |
BBa_K3702143 | BIOFAB Terminator apFAB358 | Terminator | BIOFAB | 31 | -1 | . . . gcaaaaaaccccgctgcggggttttttcgc |
BBa_K3702144 | BIOFAB Terminator apFAB359 | Terminator | BIOFAB | 83 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702145 | BIOFAB Terminator apFAB360 | Terminator | BIOFAB | 40 | -1 | . . . tgtctattatccctaagcccattttttgca |
BBa_K3702146 | BIOFAB Terminator apFAB361 | Terminator | BIOFAB | 105 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702147 | BIOFAB Terminator apFAB362 | Terminator | BIOFAB | 80 | -1 | . . . cagccgcctgtcgcccgaaggccggtcggc |
BBa_K3702148 | BIOFAB Terminator apFAB363 | Terminator | BIOFAB | 91 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702149 | BIOFAB Terminator apFAB364 | Terminator | BIOFAB | 102 | -1 | . . . cgataaagaagatttagcttcaaataaaac |
BBa_K3702150 | BIOFAB Terminator apFAB365 | Terminator | BIOFAB | 108 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702151 | BIOFAB Terminator apFAB366 | Terminator | BIOFAB | 109 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702152 | BIOFAB Terminator apFAB367 | Terminator | BIOFAB | 83 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702153 | BIOFAB Terminator apFAB368 | Terminator | BIOFAB | 96 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702154 | BIOFAB Terminator apFAB369 | Terminator | BIOFAB | 106 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702155 | BIOFAB Terminator apFAB370 | Terminator | BIOFAB | 97 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702156 | BIOFAB Terminator apFAB371 | Terminator | BIOFAB | 93 | -1 | . . . cccccgatgtggcgcagactgatttatcac |
BBa_K3702157 | BIOFAB Terminator apFAB372 | Terminator | BIOFAB | 91 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702158 | BIOFAB Terminator apFAB373 | Terminator | BIOFAB | 84 | -1 | . . . attactcaacaggtaaggcgcgaggttttc |
BBa_K3702159 | BIOFAB Terminator apFAB374 | Terminator | BIOFAB | 104 | -1 | . . . ttgggtcagtcgtataaaggtcattacgga |
BBa_K3702160 | BIOFAB Terminator apFAB375 | Terminator | BIOFAB | 80 | -1 | . . . tcccgatcttaatgaatggccggaagtggt |
BBa_K3702162 | BIOFAB Terminator apFAB377 | Terminator | BIOFAB | 91 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702163 | BIOFAB Terminator apFAB378 | Terminator | BIOFAB | 91 | -1 | . . . caagcagcagattacgcgcagaaaaaaagg |
BBa_K3702164 | BIOFAB Terminator apFAB379 | Terminator | BIOFAB | 85 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702165 | BIOFAB Terminator apFAB380 | Terminator | BIOFAB | 85 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702166 | BIOFAB Terminator apFAB381 | Terminator | BIOFAB | 90 | -1 | . . . ttccgggcattaaccctcactaacaggaga |
BBa_K3702167 | BIOFAB Terminator apFAB382 | Terminator | BIOFAB | 87 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702168 | BIOFAB Terminator apFAB383 | Terminator | BIOFAB | 88 | -1 | . . . tttataaggagacactttatgtttaagaag |
BBa_K3702169 | BIOFAB Terminator apFAB384 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacgctctcctg |
BBa_K3702170 | BIOFAB Terminator apFAB385 | Terminator | BIOFAB | 87 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702171 | BIOFAB Terminator apFAB386 | Terminator | BIOFAB | 85 | -1 | . . . ggagattttcaacatgaaaaaattattatt |
BBa_K3702172 | BIOFAB Terminator apFAB387 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacgctctcctg |
BBa_K3702174 | BIOFAB Terminator apFAB389 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacactctcccg |
BBa_K3702175 | BIOFAB Terminator apFAB390 | Terminator | BIOFAB | 89 | -1 | . . . gaccttaaaaacataaccgaggagcagaca |
BBa_K3702176 | BIOFAB Terminator apFAB391 | Terminator | BIOFAB | 82 | -1 | . . . tttggaggggcagaaagatgaatgactgtc |