Difference between revisions of "Part:BBa K3042003"
| Line 1: | Line 1: | ||
| − | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K3042003 short</partinfo> | <partinfo>BBa_K3042003 short</partinfo> | ||
This terminator is used in the DinoIII plasmid. The terminator region contains 812 base pairs. When used in combination with the RNA elements (BBa_K3042001) and the promoter region (BBa_K3042002), it drives the expression of genes in a dinoflagellate organism (Specher, 2019) | This terminator is used in the DinoIII plasmid. The terminator region contains 812 base pairs. When used in combination with the RNA elements (BBa_K3042001) and the promoter region (BBa_K3042002), it drives the expression of genes in a dinoflagellate organism (Specher, 2019) | ||
| + | |||
| + | |||
| + | <p>Primer Sets:</p> | ||
| + | <p><b>SymLHC5_3F sequence information:</b></p> | ||
| + | <p>CCAAATTTCGGAGCCTCTAGAAGATCTCGGCCAGGAGTCACAGAAAACAAG</p> | ||
| + | |||
| + | It was designed to contain an overhang of either a portion of the “termination” region or the “promoter” region, respectfully, in order to link the two PCR products. It is also designed to have an XbaI and BgIII site in between the “Promoter” and “termination” regions so that a gene, either a reporter or an antibiotic resistant gene, could be inserted in the correct orientation (Specher, 2019). | ||
| + | |||
| + | <p><b>SymkaLHC3R1 sequence information:</b></p> | ||
Revision as of 02:40, 22 October 2019
Termination Region in Dino III Plasmid
This terminator is used in the DinoIII plasmid. The terminator region contains 812 base pairs. When used in combination with the RNA elements (BBa_K3042001) and the promoter region (BBa_K3042002), it drives the expression of genes in a dinoflagellate organism (Specher, 2019)
Primer Sets:
SymLHC5_3F sequence information:
CCAAATTTCGGAGCCTCTAGAAGATCTCGGCCAGGAGTCACAGAAAACAAG
It was designed to contain an overhang of either a portion of the “termination” region or the “promoter” region, respectfully, in order to link the two PCR products. It is also designed to have an XbaI and BgIII site in between the “Promoter” and “termination” regions so that a gene, either a reporter or an antibiotic resistant gene, could be inserted in the correct orientation (Specher, 2019).
SymkaLHC3R1 sequence information: