Difference between revisions of "Part:BBa K3042001"

Revision as of 02:25, 22 October 2019

RNA complex sequence from dinoflagellate Karenia brevis

The RNA complex sequence from dinoflagellate Karenia brevis (GenBank accession # FJ434727) containing SL RNA, SRP RNA, several tRNAs, and U6. SymLHC3_5R primer and SymLHC5_3F primer were designed to contain an overhang in the “termination” region or the “promoter” region in order to link the two PCR products. The two products were used as a template for the second PCR, which resulted in a single product. The product was verified and digested with SpeI and EcoRI due to the SymkaLHC5FN1 and SymkaLHC3R1 primers used for the promoter and termination regions containing a SpeI site and an EcoRI site added to their 5’ ends for easy incorporation into pMD-Dino, which contains the RNA complex sequence. Furthermore, the pMD-Dino was PCR amplified with a DinoSL and KbrSRP-U6R1 primer set and incorporated to create a functional dinoflagellate backbone vector, DinoIII (Sprecher, 2019).

Sequence and Features

Primer Sequences:

DinoSL NCCGTAGCCATTTTGGCTCAAG

KbrSRP-U6R1 CAGAGATCAAGACATGCTTCAGGAC