Difference between revisions of "Part:BBa K3042002"
Line 2: Line 2:
 
<partinfo>BBa_K3042002 short</partinfo>
 
<partinfo>BBa_K3042002 short</partinfo>
  
−
The promoter is a G rich, intergenic region, containing 672 base pairs, between O.Marina rhodopsin tandem repeats found in the DinoIII plasmid. It is incorporated in the DinoIII plasmid to increase expression of arrO, which is a rifampin resistance gene. An increased expression of the rifampin resistance gene as well as a higher cell survival rate was observed.  
+
<dl>
−
Because no proven promoter exists for dinoflagellates at this time, the “promoter region” was determined by locating the TTTT motif, which is 65 base pairs upstream from the start codon. This motif is present 133 base pairs upstream from the start codon in the DinoIII plasmid, and the value of these sequences cannot be evaluated (Sprecher, 2019).
+
<dd>The promoter is a G rich, intergenic region, containing 672 base pairs, between O.Marina rhodopsin tandem repeats found in the DinoIII plasmid. It is incorporated in the DinoIII plasmid to increase expression of arrO, which is a rifampin resistance gene. An increased expression of the rifampin resistance gene as well as a higher cell survival rate was observed.</dd>
 +
<dd>Because no proven promoter exists for dinoflagellates at this time, the “promoter region” was determined by locating the TTTT motif, which is 65 base pairs upstream from the start codon. This motif is present 133 base pairs upstream from the start codon in the DinoIII plasmid, and the value of these sequences cannot be evaluated (Sprecher, 2019).</dd>
 +
</dl>
  
 +
<dl>
 +
<dt>Primer Sets:</dt>
 +
<p><u>SymkaLHC5FN1 sequence information:</u></p>
 +
<dd>GAGAACTAGTAAGTCCCGTGGCTGTCATATCTAG</dd>
 +
<p><u>SymLHC3_5R sequence information:</u></p>
 +
<dd>GACTCCTGGCCGAGATCTTCTAGAGGCTCCGAAATTTGGTCTA AGCAC</dd>
 +
</dl>
  
  
−
Sprecher, Brittany & Zhang, Huan & Lin, Senjie. (2019). Nuclear gene transformation in a dinoflagellate. 10.1101/602821.
+
 
 +
<p>Sprecher, Brittany & Zhang, Huan & Lin, Senjie. (2019). Nuclear gene transformation in a dinoflagellate. 10.1101/602821.</p>

Revision as of 02:30, 22 October 2019

Promoter Region in Dino III Plasmid

The promoter is a G rich, intergenic region, containing 672 base pairs, between O.Marina rhodopsin tandem repeats found in the DinoIII plasmid. It is incorporated in the DinoIII plasmid to increase expression of arrO, which is a rifampin resistance gene. An increased expression of the rifampin resistance gene as well as a higher cell survival rate was observed.
Because no proven promoter exists for dinoflagellates at this time, the “promoter region” was determined by locating the TTTT motif, which is 65 base pairs upstream from the start codon. This motif is present 133 base pairs upstream from the start codon in the DinoIII plasmid, and the value of these sequences cannot be evaluated (Sprecher, 2019).
Primer Sets:

SymkaLHC5FN1 sequence information:

GAGAACTAGTAAGTCCCGTGGCTGTCATATCTAG

SymLHC3_5R sequence information:

GACTCCTGGCCGAGATCTTCTAGAGGCTCCGAAATTTGGTCTA AGCAC


Sprecher, Brittany & Zhang, Huan & Lin, Senjie. (2019). Nuclear gene transformation in a dinoflagellate. 10.1101/602821.