Revision as of 19:03, 21 October 2019

Plac + INP-EYFP

Fusion of Ice Nucleation Protein (INP) and Enhanced Yellow Fluorescent Protein (EYFP) under the control of the Lac promoter.

Constructed using the BioSandwich protocol of Edinburgh 2011.

Usage and Biology

Cells expressing this construct are shown on the right. The cells fluoresce yellow under blue light. The INP should carry the EYFP to the outer membrane of E. coli. Our imaging technology was not good enough to confirm this, so we attempted to prove it by other means...

Fractionation experiment

We (Edinburgh 2011) centrifuged cells expressing BBa_K523013 so that the membrane fraction became localised to the bottom of the tube, and compared the fluorescence pattern with a control where EYFP was not fused to INP.

Control on left. INP-EYFP on right.		The same image passed through GIMP's auto white balance filter.

These results appear to indicate that the EYFP was successfully transported to the outer membrane; this region is the main source of fluorescence in the INP-EYFP tube. By contrast, the control tube has much more EYFP present in the cytoplasm.

More Characterization

Take a look at the experience part where you can find further Characterisations done by the iGEM13_EPF_Lausanne Team.

Improvement by BJRS_China 2018

Our project used surface display system, and we choose this part to construct the INP-mediated surface display system for our interest protein. While testing the surface display efficiency of this part, we found that the fluorescence intensity was too weak both under the uv-light（adjusted to the same OD₆₀₀）(Fig.2, middle) and under the super resolution microscope(Fig.3, middle).

To characterize the surface display efficiency of INP better, we added a strong promoter J23104 and RBS B0032 to the upstream of INP, and changed the YFP to sfGFP, to construct our parts BBa_K2833009(Fig.1).

Fig.1 the framework of BBa_K2833009

Fig.2 the fluorescence of whole cell(E.coli, DH5α) precipitation under UV-light A: intracellular expressing GFP bacteria; B: BBa_K523013 transformed bacteria; C:BBa_K2833009 transformed bacteria

Fig.3 the super resolution microscopy of different fluorescent expressing bacteria(E.coli, DH5α) A: intracellular expressing GFP bacteria; B: BBa_K523013 transformed bacteria; C:BBa_K2833009 transformed bacteria

We also conducted the cell lysis experiment to observe the distribution of GFP(figure 4). We firstly adjusted the OD₆₀₀ of all the interest overnight cultured bacteria to 1.0 and then lysed the cells using Ultrasonic Cell Disruptor. The results showed that after cell lysis followed by centrifuge, both the precipitation and supernatant shows relative strong fluorescence signal in intracellular expressing GFP bacteria(figure 4B, middle), while the signal was stronger in supernatant than in precipitation in BBa_K2833009 transformed bacteria(figure 4B, right).To further confirm this result, we removed the supernatant and observed that the signal in BBa_K2833009 transformed bacteria fragments was stronger than the GFP intracellular expressed ones(figure 4C). This suggests that the surface displayed GFP were anchored to the outer membrane and being precipitated with the cell fragment, while the intracellular expressed GFP were solved in the supernatant.

Fig.4 the fluorescence of intracellular expression of GFP and surface display of GFP via INP before and after cell lysis. A: before cell lysis; B: after cell lysis

Sequence and Features

Sequencing by BIT-China 2019

The results of the sequencing were 99% similar to the given sequence, and we believe that the lack of 1% similarity may be related to the unreliable sequencing results at the initial position (within 50 bp). Sequencing shows that the ratio of guanine and cytosine is about 55%.Because if the GC ratio of genes is between 45% and 55%, the genes is suitable for PCR amplification, so this part can be amplified well.

Fig.Sequencing results of K523013.

Primer F: ttaatacgactcactatagggagaggagg

Primer R: ggctcaccttcgggtgggcctttctgcgtttata