Difference between revisions of "Part:BBa K2715011"

Revision as of 18:25, 21 October 2019

Constitutive promoter from C.sporogenes ferrodoxin gene

Usage and Biology

This basic part is the promoter portion of the ferredoxin regulatory region from the Gram-positive organism Clostridium sporogenes. Ferredoxins (from Latin ferrum: iron + redox, often abbreviated "fdx") are iron–sulfur proteins that mediate electron transfer in a range of metabolic reactions, and the ferredoxin gene is known is to highly expressed in C. sporogenes. This promoter has been demonstrated previously to be a strong promoter in clostridial species (ref).

Characterisation

This basic part was characterised as part of a composite part, and used as a promoter which functions in both the Gram-negative E. coli and the Gram-positive Clostridium difficile. The full native regulatory region driving thiolase expression in C. sporogenes is composed of this ferredoxin promoter BBa_K2715011 and it's RBS BBa_K2715020. It's strength was assessed in E. coli using GFP as a reporter gene, the link to the characterisation data is provided below. A composite part was also assembled using gusA as a reporter gene, and this was used to assay its strength in Clostridium difficile. The composite part driving gusA is also listed below:

GFP assay:

BBa_K2715002


GUS assay:

BBa_K2715026

Nottingham iGEM2019: Characterisation of Pfdx with FAST in comparison with other Clostridium and Escherichia coli promoters.

One of the goals of goal of this experiment was to characterize the Pfdx promoter with a new reporter protein, the Fluorescence-Activating and Absorption-Shifting Tag Protein (FAST). FAST is a protein that becomes fluorescent once bound to a fluorogenic ligand. Its main advantage is to be effective in absence of molecular oxygen (contrarily to standard fluorescent reporters such as GFP), which makes it compatible with work in Clostridium. It is also more convenient to use than gusA, the standard reporter used in Clostridium. The part was characterized through a fluorescence assay in E. coli as well as in C. sporogenes, along other promoters to assess its relative strength. Fluorescence is reported as Molecule Equivalent Fluorescence per Particle (MEFL/particle) as per the recommendation of the iGEM measurement Hub.

Additionally, while preparing the assay we also discovered a mistake in the BBa K2715011 part sequence: this part was described as the native Pfdx promoter from C. sporogenes, but exhibited a point mutation compared to the Wild-Type strain (C14T). The mutation looked benign (190 bp away from START codon), but we decided to compare the registry part to the Wild-Type Pfdx sequence to prove that both the Wild-Type and the registry version of the Pfdx promoter were equivalent. The sequence of each part is given here for convenience, with the mismatch bolded:

>Pfdx (BBa_K2992016): gtgtagtagcctgCgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagata
ggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt

>Bba_K2715011: gtgtagtagcctgTgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagata
ggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt

The first observation from the expression of the FAST protein using different Clostridium and E. coli promoters is that FAST is a suitable reporter gene, both in E. coli and in Clostridium sporogenes. Indeed, quantifiable levels of fluorescence were recorded in between 6.3*10³ MEFL/particle and 1.1*10⁶ MEFL/particle. Pfdx is the strongest of the promoters tested in E. coli after Pthl, and the strongest in C. sporogenes.

Pfdx and Bba_K2715011 have equivalent expression levels (5.5*10⁵ +- 0.9*10⁵ MEFL/particle and 6*10⁵ +-1*10⁵ MEFL/particle respectively in C. sporogenes; 9*10⁵ +- 1*10⁵ 10⁵ MEFL/particle and 1.007*10⁶ +-0.009*10⁶ 10⁵ MEFL/particle respectively in E. coli). Statistical equivalence was not significant, but they were not stastically different either (p=0.779 in a two-tailed Welch t-test). In the absence of better data, we consider Pfdx and Bba_K2715011 to be interchangeable. Since our part “Pfdx” is the original, unmutated version of the ferredoxin promoter from C. sporogenes, the sequence of Bba_K2715011 documented in the registry of parts should be curated to match the native sequence of Pfdx.

For more characterisation details, please see the Results page.
https://2019.igem.org/Team:Nottingham/Results

Sequence and Features

References

Heap, J.T., Pennington, O.J., Cartman, S.T. and Minton, N.P., 2009. A modular system for Clostridium shuttle plasmids. Journal of microbiological methods, 78(1), pp.79-85.

Davis, D.F., Ward, W.W. and Cutler, M.W., 1994. Posttranslational chromophore formation in recombinant GFP from E. coli requires oxygen. In Bioluminescence and Chemiluminescence: Fundamentals and Applied Aspects. Proceedings of the 8th International Symposium on Bioluminescence and Chemiluminescence, Cambridge. Wiley, New York, NY (pp. 569-599).

Chiu, N.H. and Watson, A.L., 2017. Measuring β‐Galactosidase Activity in Gram‐Positive Bacteria Using a Whole‐Cell Assay with MUG as a Fluorescent Reporter. Current protocols in toxicology, 74(1), pp.4-44.