Difference between revisions of "Part:BBa K149001:Design"
(→Characterization) |
(→Characterization) |
||
Line 8: | Line 8: | ||
Biobrick characterization was performed by monitoring promoter activity in different high-stress environments. To perform this experiment, cells were first grown for 24 hours in Yeast Peptone Dextrose (YPD) supplemented with 2% glucose. The following day, cells were transferred to fresh YPD media supplemented with 2% glucose as well as the described concentration of methyl methane sulfonate or sodium chloride. Following 20 hours of growth in each respective environment, cell fluorescence was measured using a BeckmanCoulter FC500 MPL equipped with a 15-mW argon laser. yEGFP excitation was performed at 600v and detected using a 525±15 bandpass filter (FL1). | Biobrick characterization was performed by monitoring promoter activity in different high-stress environments. To perform this experiment, cells were first grown for 24 hours in Yeast Peptone Dextrose (YPD) supplemented with 2% glucose. The following day, cells were transferred to fresh YPD media supplemented with 2% glucose as well as the described concentration of methyl methane sulfonate or sodium chloride. Following 20 hours of growth in each respective environment, cell fluorescence was measured using a BeckmanCoulter FC500 MPL equipped with a 15-mW argon laser. yEGFP excitation was performed at 600v and detected using a 525±15 bandpass filter (FL1). | ||
− | [[Image:Autofluoresce. | + | [[Image:Autofluoresce.jpg]] |
===Source=== | ===Source=== |
Revision as of 21:48, 24 October 2008
Prp22 promoter
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Characterization
Biobrick characterization was performed by monitoring promoter activity in different high-stress environments. To perform this experiment, cells were first grown for 24 hours in Yeast Peptone Dextrose (YPD) supplemented with 2% glucose. The following day, cells were transferred to fresh YPD media supplemented with 2% glucose as well as the described concentration of methyl methane sulfonate or sodium chloride. Following 20 hours of growth in each respective environment, cell fluorescence was measured using a BeckmanCoulter FC500 MPL equipped with a 15-mW argon laser. yEGFP excitation was performed at 600v and detected using a 525±15 bandpass filter (FL1).
Source
The PRP22 promoter sequence was originally extracted from S. Cervisiae, using the 2 following primers: TAGTAGGATCCATTATTCTGGGCATCCGT;ATACTGAATTCCTCTAATATCTTTGTGTTACCTATGT. A BAMHI restriction site was included within the forward primer, while an EcoRV site was included within the reverse primer. This work was completed by our laboratory technician Simon St-Pierre.
Part Assembly
- pSB1A2 plasmid containing the BBa_p1010 cell death gene recieved from MIT in ecoli. Miniprep of pSB1A2 plasmid performed.
- Digestion of the minipreppred pSB1A2 performed using the followong reaction mixture: 25 ul of DNA, 5ul of BSA, 5 ul of Buffer 3, 1 ul EcoRI, 1 ul PstI, 13 ul H2O.
- pSB1A2 digested for 1 hr at 37C in ecoli incubator.