Difference between revisions of "Part:BBa K3100022"

Revision as of 23:56, 20 October 2019 (view source) SquarePants (Talk | contribs) ← Older edit		Revision as of 23:59, 20 October 2019 (view source) SquarePants (Talk | contribs) Newer edit →
Line 5:		Line 5:
	<strong>Usage and Biology:</strong><br>		<strong>Usage and Biology:</strong><br>
	PT7 is the most well-known inducible promoter with high transcriptional strength[1]. T7 RNAP is a single-subunit RNA polymerase that is a strong driver of transcription. It is functionally orthogonal to most hosts, acting only on its cognate promoter, PT7. In order to achieve a larger scale and more accurate regulation range, we have improved T7 promoters with different strength providing more options for the precise regulation.		PT7 is the most well-known inducible promoter with high transcriptional strength[1]. T7 RNAP is a single-subunit RNA polymerase that is a strong driver of transcription. It is functionally orthogonal to most hosts, acting only on its cognate promoter, PT7. In order to achieve a larger scale and more accurate regulation range, we have improved T7 promoters with different strength providing more options for the precise regulation.
		+	<table>
	Name Sequence Relative strength		Name Sequence Relative strength
	BBa_J64997(native T7 promoter) taatacgactcactatagg 1000		BBa_J64997(native T7 promoter) taatacgactcactatagg 1000
Line 15:		Line 16:
	BBa_K3100028 taatacgactcactcacag		BBa_K3100028 taatacgactcactcacag
	BBa_K3100029 taatacgactcactctctg		BBa_K3100029 taatacgactcactctctg
−		+	</table>
		+	<p style="text-align:center;">Fig1. T7 promoters with different strength</p>
	<strong>Characterization:</strong><br>		<strong>Characterization:</strong><br>
	<strong>1. Construction of the T7 Promoter Library</strong><br>		<strong>1. Construction of the T7 Promoter Library</strong><br>
Line 23:		Line 25:
	<p style="text-align:center;"> [[File:T--SCUT China--T7 improve.jpeg|800px]]</p>		<p style="text-align:center;"> [[File:T--SCUT China--T7 improve.jpeg|800px]]</p>
−	<p style="text-align:center;">Fig 1. Site-saturation mutagenesis was conducted to obtain the T7 mutants</p>	+	<p style="text-align:center;">Fig 2. Site-saturation mutagenesis was conducted to obtain the T7 mutants</p>
−		+
		+	<table>
	vector 1.F CCCGCGAAATTAATACGACTCACTNNNNNGGAATTGTGAGCGGATAAC		vector 1.F CCCGCGAAATTAATACGACTCACTNNNNNGGAATTGTGAGCGGATAAC
	vector 1.R TACCGCACAGATGCGTAAG		vector 1.R TACCGCACAGATGCGTAAG
	vector 2.F TTCTCCTTACGCATCTGT		vector 2.F TTCTCCTTACGCATCTGT
−	vector 2.R AGTGAGTCGTATTAATTTCG	+	vector 2.R AGTGAGTCGTATTAATTTCG</table>
−	Table 1: Primers for site-saturation mutagenesis	+	<p style="text-align:center;">Table 1: Primers for site-saturation mutagenesis</p>
−	2. T7 Mutant Screening and Determination of GFP Fluorescence	+	<strong>2. T7 Mutant Screening and Determination of GFP Fluorescence</strong><br>
	T7 mutants were preliminarily selected by fluorescence of colonies grown on LB agar plates with Lactose. These mutants were inoculated in 2ml LB medium and cultured at 37 °C with agitation at 250 rpm for 12 h. Then, 1:100 inoculate to 200μl LB medium (with 0.2mM IPTG) in 96 - well plates at 30°C with agitation at 250 rpm for 16 h. The excitation wavelength was set to 553 nm, and the emission wavelength was set to 583 nm. The optical density of bacteria at 600 nm was detected with a spectrophotometer.		T7 mutants were preliminarily selected by fluorescence of colonies grown on LB agar plates with Lactose. These mutants were inoculated in 2ml LB medium and cultured at 37 °C with agitation at 250 rpm for 12 h. Then, 1:100 inoculate to 200μl LB medium (with 0.2mM IPTG) in 96 - well plates at 30°C with agitation at 250 rpm for 16 h. The excitation wavelength was set to 553 nm, and the emission wavelength was set to 583 nm. The optical density of bacteria at 600 nm was detected with a spectrophotometer.
	Finally, we have screened 8 different strength T7 mutants. The following figure is fluorescence/OD600 of them.		Finally, we have screened 8 different strength T7 mutants. The following figure is fluorescence/OD600 of them.

---

Revision as of 23:59, 20 October 2019

T7 promoter variants family member

Usage and Biology:
PT7 is the most well-known inducible promoter with high transcriptional strength[1]. T7 RNAP is a single-subunit RNA polymerase that is a strong driver of transcription. It is functionally orthogonal to most hosts, acting only on its cognate promoter, PT7. In order to achieve a larger scale and more accurate regulation range, we have improved T7 promoters with different strength providing more options for the precise regulation.

Name Sequence Relative strength BBa_J64997(native T7 promoter) taatacgactcactatagg 1000 BBa_K3100022 taatacgactcactataag BBa_K3100023 taatacgactcactttagt BBa_K3100024 taatacgactcacttttaa BBa_K3100025 taatacgactcacttttga BBa_K3100026 taatacgactcactgttag BBa_K3100027 taatacgactcactaaagt BBa_K3100028 taatacgactcactcacag BBa_K3100029 taatacgactcactctctg

Fig1. T7 promoters with different strength

Characterization:
1. Construction of the T7 Promoter Library
A T7 promoter library was constructed through site-saturation mutagenesis, and an efficient screening method based on GFP fluorescence detection was established.

The site-saturation mutagenesis DNA fragment pET30a(+)-PT7-RFP vector 1 was obtained using the plasmid pET30a(+)-PT7-RFP as the template and vector 1.F (the sequence containing the mutation in promoter)and vector 1.R as the primers. At the same time, vector 2.F and vector 2.R as the primers to obtain pET30a(+)-PT7-RFP vector 1 by PCR. And then construct pET30a(+)-PT7 mutagenesis -RFP with pET30a(+)-PT7-RFP vector 1 and vector 2 by Gibson Assembly.

Fig 2. Site-saturation mutagenesis was conducted to obtain the T7 mutants

vector 1.F CCCGCGAAATTAATACGACTCACTNNNNNGGAATTGTGAGCGGATAAC vector 1.R TACCGCACAGATGCGTAAG vector 2.F TTCTCCTTACGCATCTGT vector 2.R AGTGAGTCGTATTAATTTCG

Table 1: Primers for site-saturation mutagenesis

2. T7 Mutant Screening and Determination of GFP Fluorescence
T7 mutants were preliminarily selected by fluorescence of colonies grown on LB agar plates with Lactose. These mutants were inoculated in 2ml LB medium and cultured at 37 °C with agitation at 250 rpm for 12 h. Then, 1:100 inoculate to 200μl LB medium (with 0.2mM IPTG) in 96 - well plates at 30°C with agitation at 250 rpm for 16 h. The excitation wavelength was set to 553 nm, and the emission wavelength was set to 583 nm. The optical density of bacteria at 600 nm was detected with a spectrophotometer. Finally, we have screened 8 different strength T7 mutants. The following figure is fluorescence/OD600 of them.

Fig. 2: fluorescence/OD600 of T7 mutants

Reference: [1] Nie, Z., Luo, H., Li, J. et al. Appl Biochem Biotechnol (2019). https://doi.org/10.1007/s12010-019-03113-y

Sequence and Features