Difference between revisions of "Part:BBa K2951014"
(→‎Result)
Line 22: Line 22:
 
<html>
 
<html>
 
<div style="padding-left:20%">
 
<div style="padding-left:20%">
−
     <img src="https://2019.igem.org/wiki/images/5/50/T--CSMU_Taiwan--HA3-a.jpeg" style="width:400px; text-align: center;">
+
     <img src="https://2019.igem.org/wiki/images/5/50/T--CSMU_Taiwan--HA3-a.jpeg" style="width:600px; text-align: center;">
 
   <br>
 
   <br>
 
   <p> Fig1. There is a significant logarithmic relevance between aptamer HA3-4 and the target protein hemagglutinin. Lower value comparing with target protein shows lower relevance between HA3-4 and the non-target protein(HA1). As a result ,we found that it is actually effective to distinguish the two protein.
 
   <p> Fig1. There is a significant logarithmic relevance between aptamer HA3-4 and the target protein hemagglutinin. Lower value comparing with target protein shows lower relevance between HA3-4 and the non-target protein(HA1). As a result ,we found that it is actually effective to distinguish the two protein.
Line 31: Line 31:
 
<html>
 
<html>
 
<div style="padding-left:20%">
 
<div style="padding-left:20%">
−
<img src="https://2019.igem.org/wiki/images/a/ac/T--CSMU_Taiwan--HA3-b.jpeg" style="width:400px; text-align: center;">
+
<img src="https://2019.igem.org/wiki/images/a/ac/T--CSMU_Taiwan--HA3-b.jpeg" style="width:600px; text-align: center;">
 
   <br>
 
   <br>
 
   <p> Fig3a. The sequence of HA3-4 were sent to <a href="http://unafold.rna.albany.edu/?q=mfold">Mfold</a> server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above.
 
   <p> Fig3a. The sequence of HA3-4 were sent to <a href="http://unafold.rna.albany.edu/?q=mfold">Mfold</a> server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above.
Line 43: Line 43:
 
<html>
 
<html>
 
<div style="padding-left:20%">
 
<div style="padding-left:20%">
−
<img src="https://2019.igem.org/wiki/images/8/85/T--CSMU_Taiwan--HA3-c.png" style="width:400px; text-align: center;">
+
<img src="https://2019.igem.org/wiki/images/8/85/T--CSMU_Taiwan--HA3-c.png" style="width:600px; text-align: center;">
 
   <br>
 
   <br>
 
   <p> Fig.5Docking structural model of AptHA3-4 with HA3. (visualization by<a href="https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html ">iCn3D</a>)
 
   <p> Fig.5Docking structural model of AptHA3-4 with HA3. (visualization by<a href="https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html ">iCn3D</a>)

Revision as of 14:47, 20 October 2019


Apt-HA3

DNA Probe 7

Usage and Biology

This part is a ssDNA aptamer that targets the hemagglutinin of influenza A virus H3N2 (A/Perth/16/2009). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “HA3-4” due to the target protein it should recognize and our label with number during experimental process.

Characterization

Titer value

The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing ELISA. According to the coated protein, two important factors are tested:

  • Affinity-Non-competitive ELISA by coating target protein
  • Specificity-competitive ELISA by coating un-target protein.

Non-competitive ELISA

Method

We set up with different concentration of target protein(HA3) and non-target protein(HA1) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.

  • HA1: this is the abbreviation for hemagglutinin of Influenza A H1N1 (A/New York/18/2009) and it act as a non-target protein in this ELISA experiment.

Result


Fig1. There is a significant logarithmic relevance between aptamer HA3-4 and the target protein hemagglutinin. Lower value comparing with target protein shows lower relevance between HA3-4 and the non-target protein(HA1). As a result ,we found that it is actually effective to distinguish the two protein.


Fig3a. The sequence of HA3-4 were sent to Mfold server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above. Fig.3b The 3D structure of HA3-4 is predicted utilizing RNAcomposer operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.



Fig.5Docking structural model of AptHA3-4 with HA3. (visualization byiCn3D)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]