Difference between revisions of "Part:BBa K2942705"

Revision as of 17:31, 21 October 2019

CMV promoter+eGFP CMV promoter is recognized as the most powerful promoter to start the gene expression of eukaryon. Here we also insert eGFP which is a type of GFP derivatives by mutation to assess the effect of the gene expression in eukaryon. eGFP mutation greatly improved the spectral characteristics of GFP, resulting in increased fluorescence, photostability, and a shift of the major excitation peak to 488 nm, with the peak emission kept at 509 nm[1]. This matched the spectral characteristics of commonly available FITC filter sets, so it could be used by the researcher more efficiently, such as using it in mammalian cells. The CMV(BBa_I712004) and eGFP(BBa_I914891) was linked into the vector pSB1A3 between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination. The primer designing and the experiment procedure were consistent with the protocol of the ClonExpress® MultiS One Step Cloning Kit, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2)and the image of transfection cells observed under a fluorescence microscope (Fig.3). Primers for homologous recombination: PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG PSBA3-R CGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGG CMV-F TAAGGATGATTTCTGGAATTCGTGATGCGGTTTTGGCAGT CMV-GFP-R TCCTCGCCCTTGCTCACCATAGCTCTGCTTATATAAACCT GFPF ATGGTGAGCAAGGGCGAGGAGCTGT GFPR CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG

Primers for PCR: F TTCGCTAAGGATGATTTCTGGAATTC R CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG

Primers for sequencing: F TTCGCTAAGGATGATTTCTGGAATTC R CTTGTACAGCTCGTCCATG

Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.

Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files.

Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. Fluorescence was observed 24h after the transfection.

In conclusion, this result well confirmed that CMV+eGFP transformant certainly can be used to express the gene of interest and show its expression in eukaryu.

[1] Pédelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS (Jan 2006). "Engineering and characterization of a superfolder green fluorescent protein". Nature Biotechnology. 24 (1): 79–88. Sequence and Features

@@ Line 1: / Line 1: @@
-===CMV promoter+eGFP===
+CMV promoter+eGFP
 CMV promoter is recognized as the most powerful promoter to start the gene expression of eukaryon. Here we also insert eGFP which is a type of GFP derivatives by mutation to assess the effect of the gene expression in eukaryon. eGFP mutation greatly improved the spectral characteristics of GFP, resulting in increased fluorescence, photostability, and a shift of the major excitation peak to 488 nm, with the peak emission kept at 509 nm[1]. This matched the spectral characteristics of commonly available FITC filter sets, so it could be used by the researcher more efficiently, such as using it in mammalian cells.
 The CMV(BBa_I712004) and eGFP(BBa_I914891) was linked into the vector pSB1A3 between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination. The primer designing and the experiment procedure were consistent with the protocol of the ClonExpress® MultiS One Step Cloning Kit, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2)and the image of transfection cells observed under a fluorescence microscope (Fig.3).
 Primers for homologous recombination:
 PSBA3-F	AACTGCAGTCCGGCAAAAAAGGGCAAG
@@ Line 20: / Line 19: @@
- [[file:2705_1.png]]
+[[file:lyt651.png|720px]]
-Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.
+Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.
- [[file:2705_2.png|720px]]
+[[file:lyt652.png|720px]]
 Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files.
+[[file:lyt653.png|720px]]
 Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. Fluorescence was observed 24h after the transfection.