Difference between revisions of "Part:BBa K2951004"

(→‎Characterization)
Line 9: Line 9:
  
 
===Usage and Biology===
 
===Usage and Biology===
−
This part is a ssDNA aptamer that targets the nucleocapsid protein of influenza A virus (A/Michigan/297/2017(H1N1)).(sequence from NCBI(CY261696.1) gene:34-1530)
+
This part is a ssDNA aptamer that targets the nucleocapsid protein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from [https://www.ncbi.nlm.nih.gov/nuccore/CY261696.1 NCBI(CY261696.1)] gene:34-1530). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-4” due to the target protein it should recognize and our label with number during experimental process.
−
The probe can be used for on-site influenza detection.
+
==Characterization==
−
 
+
===Titer value===
−
===Characterization===
+
  The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested:
−
====Titer Value====
+
−
The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested:
+
 
{|
 
{|
 
! style="text-align:left;"| Factor
 
! style="text-align:left;"| Factor
Line 26: Line 24:
 
|-
 
|-
 
|}
 
|}
 +
 +
===Non-competitive ELISA===
 +
===Method===
 +
We created a series of protein with different concentration via serial dilution and coat these protein respectively to 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.
 +
===Result===
 +
<html>
 +
<div style="padding-left:20%">
 +
    <img src=" https://2019.igem.org/wiki/images/d/de/T--CSMU_Taiwan--NP4-1.jpeg " style="width:400px; text-align: center;">
 +
  <br>
 +
  <p> Fig.1 (A)NPA-4 shows significant dose-dependent property. (B) We tested NPA-4 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-4 has the higher affinity toward NPA protein and lower affinity toward NPB which means higher specificity.
 +
</p>
 +
</div>
 +
</html>
 +
 +
 +
===Competitive ELISA===
 +
===Method===
 +
Coat the non-target protein to 96-well microplate, each well containing the same amount. After blocking, primary antibodies were added, which is the selected aptamers. At the same time, add the same kind of protein with the coated ones in different concentration as competitive. OD value was then measured by ELISA reader at the wave length of 450nm. If the protein added in the solution which compete with the coated protein could significantly grab our aptamer and left the plate by washing, we can say the aptamer have high affinity to the protein we tested.
 +
===Result===
 +
<html>
 +
<div style="padding-left:20%">
 +
    <img src=" https://2019.igem.org/wiki/images/e/e1/T--CSMU_Taiwan--NP4-2.jpeg" style="width:400px; text-align: center;">
 +
  <br>
 +
  <p> Fig3A. The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A)When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution is capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was no significant decrease in measured OD value, proving its specificity.
 +
</p>
 +
</div>
 +
</html>
 +
<html>
 +
<div style="padding-left:20%">
 +
    <img src=" https://2019.igem.org/wiki/images/f/f9/T--CSMU_Taiwan--NP4-3.jpeg
 +
" style="width:400px; text-align: center;">
 +
  <br>
 +
  <p> Fig3a. The sequence of NPA-4 were sent to [http://unafold.rna.albany.edu/?q=mfold Mfold] server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above.
 +
Fig.3b The 3D structure of NPA-4 is predicted utilizing [http://rnacomposer.cs.put.poznan.pl/ RNAcomposer] operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.
 +
</p>
 +
</div>
 +
</html>
 +
 +
<html>
 +
<div style="padding-left:20%">
 +
    <img src=" https://2019.igem.org/wiki/images/c/cb/T--CSMU_Taiwan--NP4-4.png" style="width:400px; text-align: center;">
 +
  <br>
 +
  <p> Fig.5Docking structural model of AptNPA-4 with NPA. (visualization by [https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html iCn3D])
 +
</p>
 +
</div>
 +
</html>
  
 
<!-- -->
 
<!-- -->

Revision as of 11:05, 20 October 2019


Apt-influenzaA-NP

Usage and Biology

This part is a ssDNA aptamer that targets the nucleocapsid protein of influenza A virus (A/Michigan/297/2017(H1N1), sequence from NCBI(CY261696.1) gene:34-1530). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “NPA-4” due to the target protein it should recognize and our label with number during experimental process.

Characterization

Titer value

 The titer value of this aptamer towards its target protein nucleocaspid is determined by practicing two types of ELISA. According to the coated protein, two important factors are tested:
Factor Method
Affinity by coating target protein
Specificity by coating un-target protein

Non-competitive ELISA

Method

We created a series of protein with different concentration via serial dilution and coat these protein respectively to 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm. ===Result===


Fig.1 (A)NPA-4 shows significant dose-dependent property. (B) We tested NPA-4 in specificity test have significant lower value comparing with the test of NPA protein. The results show that NPA-4 has the higher affinity toward NPA protein and lower affinity toward NPB which means higher specificity.


Competitive ELISA

Method

Coat the non-target protein to 96-well microplate, each well containing the same amount. After blocking, primary antibodies were added, which is the selected aptamers. At the same time, add the same kind of protein with the coated ones in different concentration as competitive. OD value was then measured by ELISA reader at the wave length of 450nm. If the protein added in the solution which compete with the coated protein could significantly grab our aptamer and left the plate by washing, we can say the aptamer have high affinity to the protein we tested. ===Result===


Fig3A. The x axis represents the amount competitive protein added in the solution, and the y axis is the OD value measured. (A)When increasing the amount of competitive protein (target: influenza A nucleocapsid protein in affinity test), the OD value decrease shows that the free protein in the solution is capable of grabbing our aptamers. (B)When increasing the amount of competitive protein (non-target: influenza B protein in specificity test) there was no significant decrease in measured OD value, proving its specificity.


Fig3a. The sequence of NPA-4 were sent to [http://unafold.rna.albany.edu/?q=mfold Mfold] server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above. Fig.3b The 3D structure of NPA-4 is predicted utilizing [http://rnacomposer.cs.put.poznan.pl/ RNAcomposer] operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.


Fig.5Docking structural model of AptNPA-4 with NPA. (visualization by [https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html iCn3D])

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]