Difference between revisions of "Part:BBa K2983014"

Revision as of 14:15, 19 October 2019

Loop Gamma-A

This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.

Usage and Biology

The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the Loop Gamma-A is as fellow : GCTCTTCATACAGGAGTGAGACC

Figure1: Loop Gamma-A structure

Blue triangle: SapI fixation site (GCTCTTC)

Red triangle : BsaI fixation site (GAGACC)

Blue circle : overhang formed by SapI after cutting (TAC)

Red circle: overhang formed by BsaI after cutting (GGAG)

Sequence and Features