Difference between revisions of "Part:BBa K2983014"
(→Usage and Biology=) |
|||
| Line 5: | Line 5: | ||
This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites. | This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites. | ||
| − | ==Usage and Biology=== | + | ===Usage and Biology=== |
The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the Loop Gamma-A is as fellow : GCTCTTCATACAGGAGTGAGACC | The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the Loop Gamma-A is as fellow : GCTCTTCATACAGGAGTGAGACC | ||
| Line 18: | Line 18: | ||
Blue circle : overhang formed by SapI after cutting (TAC) | Blue circle : overhang formed by SapI after cutting (TAC) | ||
| − | red circle: overhang formed by BasI after cutting | + | red circle: overhang formed by BasI after cutting (GGAG) |
Revision as of 14:15, 19 October 2019
Loop Gamma-A
This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.
Usage and Biology
The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the Loop Gamma-A is as fellow : GCTCTTCATACAGGAGTGAGACC
Blue triangle: SapI fixation site (GCTCTTC)
Red triangle : BsaI fixation site (GAGACC)
Blue circle : overhang formed by SapI after cutting (TAC)
red circle: overhang formed by BasI after cutting (GGAG)
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 18
Illegal SapI site found at 1