Difference between revisions of "Part:BBa K2983013"

Revision as of 14:14, 19 October 2019

Loop F-Gamma

This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.

Usage and Biology

The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the Loop f-Gamma is as fellow : GGTCTCACGCTATACTGAAGAGC

Figure1: Loop F-Gamma structure

Blue triangle: SapI fixation site (GCTCTTC)

Red triangle : BsaI fixation site (GAGACC)

Blue circle : overhang formed by SapI after cutting (TAC)

Yellow circle: overhang formed by BasI after cutting (CGCT)

Sequence and Features