Difference between revisions of "Part:BBa K2993001"

Revision as of 18:55, 20 October 2019

ZincFingerArray1

This part encodes for the six zinc-finger arrays which can bind to a specific DNA sequence encoded in our DNA-bridges. This protein sequence can be used in other projects to connect other proteins with DNA/RNA sequences such as we were planning to do in our own project.

The zinc finger arrays were designed with the help of www.zincfingertools.com. There we made sure that the DNA binding sequence doesn't surpass more than two matches with the genome of E.coli itself so that we do not get any false positive binding reactions.

This part has been integrated in BBa_K2993000. Here it is linked to a split-TEV protein. But this part can also be used for other DNA-binding studies and experiments. This part is only designed for direct translation, so it does not contain a start codon. If you want to use this part only, we suggest designing primers in which you add the start codon ATG to the very beginning of THIS sequence and a stop codon at the END !!!

This part has been sequence optimized for E.coli BL21(DE3) expression. We suggest using good expression vectors. When bringing this protein to expression, it is important to keep in mind that functional zinc fingers need zinc (Zn2+). When performing IMAC purification with Nikkel columns (Ni2+), you need to keep in mind that hindrance could occur in purification.

The sequence of this part is:

CTGGAGCCGGGTGAAAAACCGTACAAATGCCCTGAATGCGGTAAAAGCTTTAGTCGC AGCGACAAACTTGTGCGCCACCAGCGTACTCACACCGGCGAAAAACCATATAAATGC CCGGAGTGTGGCAAAAGCTTCAGTCGCGAAGATAACCTTCACACCCACCAGCGCACC CATACCGGCGAAAAGCCGTATAAATGCCCAGAATGTGGCAAAAGCTTTAGCCATCGC ACGACCCTGACCAACCACCAGCGCACCCACACCGGCGAGAAACCGTATAAATGTCCC GAGTGTGGAAAGTCTTTCTCTACAAGTGGCCATTTGGTGCGTCATCAACGTACTCAC ACCGGAGAAAAGCCGTACAAATGCCCAGAATGCGGTAAGTCCTTCTCTCGTGAGGAC AACTTGCATACCCATCAACGCACGCACACGGGTGAGAAACCATATAAGTGCCCCGAG TGCGGAAAATCGTTTTCTCAGTCAAGTTCCTTAGTCCGCCATCAGCGCACACACACTGGGAAGAAGACTAGC

Even though the protein has not been brought to expression, theoretical estimations were made with known software from ExPASy as shown below:

Number of amino acids: 348

Molecular weight: 38330.65

Theoretical pI: 9.52

Amino acid composition: Ala (A) 4 1.1% Arg (R) 21 6.0% Asn (N) 10 2.9% Asp (D) 8 2.3% Cys (C) 14 4.0% Gln (Q) 13 3.7% Glu (E) 20 5.7% Gly (G) 45 12.9% His (H) 29 8.3% Ile (I) 10 2.9% Leu (L) 18 5.2% Lys (K) 28 8.0% Met (M) 3 0.9% Phe (F) 15 4.3% Pro (P) 21 6.0% Ser (S) 35 10.1% Thr (T) 38 10.9% Trp (W) 0 0.0% Tyr (Y) 9 2.6% Val (V) 7 2.0% Pyl (O) 0 0.0% Sec (U) 0 0.0%

(B)   0	  0.0%
(Z)   0	  0.0%
(X)   0	  0.0%

Total number of negatively charged residues (Asp + Glu): 28 Total number of positively charged residues (Arg + Lys): 49

Atomic composition:

Carbon C 1645 Hydrogen H 2564 Nitrogen N 520 Oxygen O 510 Sulfur S 17

Formula: C1645H2564N520O510S17 Total number of atoms: 5256

Extinction coefficients:

This protein does not contain any Trp residues. Experience shows that this could result in more than 10% error in the computed extinction coefficient.

Extinction coefficients are in units of M-1 cm-1, at 280 nm measured in water.

Ext. coefficient 14285 Abs 0.1% (=1 g/l) 0.373, assuming all pairs of Cys residues form cystines

Ext. coefficient 13410 Abs 0.1% (=1 g/l) 0.350, assuming all Cys residues are reduced

Estimated half-life:

The N-terminal of the sequence considered is M (Met).

The estimated half-life is: 30 hours (mammalian reticulocytes, in vitro).

                           >20 hours (yeast, in vivo).
                           >10 hours (Escherichia coli, in vivo).

Instability index:

The instability index (II) is computed to be 33.71 This classifies the protein as stable.

Aliphatic index: 38.36

Grand average of hydropathicity (GRAVY): -1.035

Sequence and Features