Difference between revisions of "Part:BBa K2973011"

Revision as of 00:12, 16 October 2019

Toehold 13 β-Lactamase Geobacillus kaustophilus

This composite part consists of T7 Promoter (BBa_J64997) and T7 Terminator (BBa_K731721), the Ribosomal Binding Site (AGAGGAGA), a Toehold switch and the CDS of the Beta-lactamase without the signal peptide. Toehold switch systems are composed of two RNA strands referred to as the switch and trigger. The switch RNA contains the coding sequence of the regulated beta lactamase gene. Upstream of this coding sequence is a hairpin-based processing module containing both a strong RBS and a start codon that is followed by a common 21 nt linker sequence coding for low-molecular-weight amino acids added to the N terminus of the gene of interest. A single-stranded toehold sequence at the 5’ end of the hairpin module provides the initial binding site for the trigger RNA strand. This trigger molecule contains an extended single stranded region that completes a branch migration process with the hairpin to expose the RBS and start codon, thereby initiating translation of the b-lactamase. This toehold was designed to detect the short 16S rRNA sequence GAAACCGGAGCTAATACCGGATAACACCGAAGACCG of Geobacillus kaustophilus. Beta lactamase (EC 3.5.2.6) is a small monomeric enzyme(29kDa) that is produced by bacteria and gives them resistance to antibiotics with β-lactam ring because of its ability to hydrolyze the amid bond in the β-lactam ring. This ability can be exploited in order to use b-lactamase as a protein reporter by providing the enzyme with its chromogenic substrate Nitrocefin. Nitrocefin is a chromogenic cephalosporin first reported in 1972 as a novel and straightforward substrate used to detect bacteria resistant to β-lactam antibiotics. Normally, a nitrocefin solution has yellow color, but after its hydrolysis by b-lactamase , the color of the solution turns red, allowing in that way the detection of the enzyme.

The performance of our designed Toehold 13, compared to the 32B Toehold (BBa_K2973007), is depicted below. We have also added a non-regulated lactamase CDS as a positive control

Sequence and Features

This toehold was designed in order to detect the 16S rRNA of the hyperthermophile Geobacillus kaustophilus. The design was made with the NUPACK software http://www.nupack.org/