Difference between revisions of "Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection"
(New page: The Weiss RBS family was contributed to the Registry by Prof. Ron Weiss, Princeton. ==Description== The Weiss RBS family are suitable for general protei...) |
|
(No difference)
|
Revision as of 01:56, 7 September 2008
Description
The Weiss RBS family are suitable for general protein expression in E. coli or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application. The family of synthetic RBS were designed by [http://weisswebserver.ee.princeton.edu/users/rweiss/ Ron Weiss].
Obtaining Weiss RBS parts
Via de novo synthesis: Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligo's and annealed. See here for a tutorial on how to construct short parts via oligo annealing.
Via the Registry distribution: The RBS parts are included in the Registry distribution. ved from these RBS will not match the physical sequence
Characterization of the Weiss RBS family
Weiss RBS family members
Identifier | Sequencea | Strength |
---|---|---|
BBa_B0030 | TCTAGAGATTAAAGAGGAGAAATACTAGATG | 1 |
BBa_B0031 | TCTAGAGTCACACAGGAAACCTACTAGATG | 0.12 |
BBa_B0032 | TCTAGAGTCACACAGGAAAGTACTAGATG | 0.5 |
BBa_B0033 | TCTAGAGTCACACAGGACTACTAGATG | 0.012 |
aThe sequence of individual RBS are shown in black and red. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green. See the "Obtaining Anderson RBS parts" section above for a description of how the physical DNA sequence of the Anderson RBS parts in the Registry differs slightly from the BioBrick® standard.