Difference between revisions of "Part:BBa K2834006"

Revision as of 18:14, 17 October 2018

Expressible abaecin antimicrobial peptide from Apis mellifera

This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, abaecin, a 6x His-Tag and a T1 terminator from E. coli. This composite enables the expression of abaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.

As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, abaecin and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTCCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAA AGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC

Usage and Biology

Antimicrobial peptides (AMPs) are oligopeptides with a varying number (from five to over a hundred) of amino acids that have a broad spectrum of targeted organisms ranging from viruses to parasites¹. AMPs are molecules present in the immune system of multinuclear organisms, acting in the defense against invaders such as gram-positive, gram-negative bacteria and fungi³.

The antimicrobial effect of peptides, and their production, has been studied in the immunological system of animals, such as bees. These peptides were directly extracted from the animal’s hemolymph, which were purified and tested in bacterial culture, presenting antimicrobial activity³.

Recently, four families of AMPs (i.e., apidaecins, abaecin, hymenoptaecin and defensins) have been described in the honey bee². The abaecin peptide, found in Apis mellifera, is one of the largest proline-rich antimicrobial peptide, with 34 amino acids containing 10 prolines (29%) and no cysteine residues. Prolines are uniformly distributed through the peptide length, preventing the α-helical conformation³. Abaecin inhibits growth of G+ bacteria. The abaecin precursor was found both in adult bees and in bee brood hemolymph. Expression and abundance of abaecin is rapidly up-regulated in response to bacterial infection, there is a time-dependent increase in expression of this peptide in first-instar larvae after P. larvae spores exposure². In our project, abaecin is expressed in E. coli BL21 (DE3) to be used against the bacteria that cause American and European Foulbrood.

Characterization of abaecin atimicrobial peptide

This composite will be characterized with the intention of expressing abaecin in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotimicrobial susceptibility testing by measuring OD₆₀₀ in broth.

BioBrick™ assembly

To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 361 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2388 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, linearized plasmid with one enzyme, and linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.

_{Figure 1. (On the left) SnapGene® map of BBa__K2834006. (On the right) Agarose gel electrophoresis of BBa__K2834006 compared with NEB Quick-Load® Purple 1Kb Plus DNA Ladder, where the highlighted band corresponds to approximately 2388 bp.}

IPTG protein induction and extraction

Following the construction of the BioBrick, it was necessary to induce protein production. Since the T7 promoter regulates transcription of the construct, isopropyl β-D-1 thiogalactopyranoside (IPTG) is used as an inducer for T7 RNA polymerase production. The concentration of IPTG used was 0.5 mM. After induction, the cultures were incubated for six hours at 37 °C and 225 rpm. After that, protein extraction by lysis solution was made in order to obtain the soluble peptides. For insoluble peptides, the sample was treated with lysis solution+6M urea.

SDS-PAGE

After protein extraction, electrophoresis in a polyacrylamide gel (12%) was performed to corroborate the peptide of interest was indeed expressed. To calculate the molecular weight of the peptide, the Promega Biomath Calculator was used. The DNA length (bp) of the peptide was introduced, and Promega’s tool calculated the molecular weight in kDa. For abaecin, a band at 5.94 kDa was expected.

Antibiotimicrobial susceptibility testing

In order to prove the antibacterial activity of abaecin, antimicrobial susceptibility tests were performed for two different bacteria: Bacillus subtilis and Streptococcus pyogenes. B. subtilis was chosen because it is one of the best known Gram-positive microorganisms and S. pyogenes was chosen because it is one of the most important bacterial pathogens to humans. They both are widely known, commonly used, and thus allowed to better analyze the activity that the peptide has.

Being unable to isolate our peptides by affinity tag purification due to lack of equipment, crude protein extract was used in the experiment. In order to validate the experiment, different concentrations of the peptide and several controls were used; 15 ml of LB broth, with a bactericide agent or a control, were inoculated with 100μl of the overnight culture of each bacteria. Afterward, OD₆₀₀ was measured at 3, 6, 9, and 21 hours after inoculation.

Antibiotimicrobial susceptibility test results

B. subtilis (figure 2a) was treated with 29.74 μg/mL (LC) and 148.7 μg/mL (HC) of total proteins of transformed E. coli BL21 (DE3) with abaecin. Also, it was treated with 29.565 μg/mL (LC) and 147.825 μg/mL (HC) of untransformed E. coli BL21 (DE3) for negative control. A culture of B. subtilis was used as a negative control as well. At 21 h, both concentrations of abaecin produced a decrease in OD₆₀₀ compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with abaecin OD₆₀₀ decreases in 16.08% and with the highest one it decreases in 17.16%.

S. pyogenes (figure 2b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of abaecin produced a decrease in OD₆₀₀ compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with abaecin OD₆₀₀ decreases in 3.77% and with the highest one it decreases in 14.39%.

_{Figure 2. Antimicrobial susceptibility testing results for abaecin. a) B. subtilis challenged with low (LC) and high (HC) concentrations of total proteins of transformed E. coli BL21 (DE3) with abaecin and total proteins of untransformed E. coli BL21 (DE3). b) S. pyogenes challenged with low (LC) and high (HC) concentrations of total proteins of transformed E. coli BL21 (DE3) with abaecin and total proteins of untransformed E. coli BL21 (DE3).}

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 86
  
• 1000
  COMPATIBLE WITH RFC[1000]

References

1. Bahar, A., & Ren, D. (2013). Antimicrobial Peptides. Pharmaceuticals, 6(12), 1543–1575. doi.org/10.3390/ph6121543
2. Danihlík, J., Aronstein, K., & Petřivalský, M. (2015). Antimicrobial peptides: a key component of honey bee innate immunity. Journal of Apicultural Research, 54(2), 123–136. doi:10.1080/00218839.2015.1109919
3.Prudencio, D., Franco, J., Goulart, L., Nicolau, N. & Ueira, C. (2017). Heterologous expression of abaecin peptide from Apis mellifera in Pichia pastoris. Microbial Cell Factories. doi.org/10.1186/s12934-017-0689-6