Difference between revisions of "Part:BBa K2885001"

Line 5: Line 5:
 
Gold binding polypeptide (GBP) can be used as an anchor component, robustly binding to a gold surface and it is consisted of 14 amino acids (MHGKTQATSGTIOS) triplication (Braun, Sarikaya, & Schulten, 2002; Brown, Sarikaya, & Johnson, 2000).
 
Gold binding polypeptide (GBP) can be used as an anchor component, robustly binding to a gold surface and it is consisted of 14 amino acids (MHGKTQATSGTIOS) triplication (Braun, Sarikaya, & Schulten, 2002; Brown, Sarikaya, & Johnson, 2000).
  
The strong coupling property of GBP onto a gold patterned substrate was delineated in a previous investigation (Tamerler et al., 2006). it is, nevertheless, unclear how GBP binds to the gold substrate (Braun et al., 2002). Intriguingly, Fenter et al. (1994) clarified that the sequences of GBP do not include any cysteine residue leading to a covalent bond with a gold substrate via a thiol linkage. Also, an important role of GBP binding seems to be caused by the polar groups exposed via the amino acids (M, K, T, Q, and S) residues. Considering the concept above, the anitparallel beta-sheet sturcture of GBP might be linked to the gold surface via hydroxyl groups. Hydroxyl group and the amine ligands of GBP seem to percieve the gold surface the structure of atomic lattice on the gold surface. (인용논문). Thus, the binding pecuriality of GBP can be an useful avenue for protein immobilization on gold substrate, substantially contributing to the biosensor development.
+
The strong coupling property of GBP onto a gold patterned substrate was delineated in a previous investigation (Tamerler et al., 2006). it is, nevertheless, unclear how GBP binds to the gold substrate (Braun et al., 2002). Intriguingly, Fenter et al. (1994) clarified that the sequences of GBP do not include any cysteine residue leading to a covalent bond with a gold substrate via a thiol linkage. Also, an important role of GBP binding seems to be caused by the polar groups exposed via the amino acids (M, K, T, Q, and S) residues. Considering the concept above, the anitparallel beta-sheet sturcture of GBP might be linked to the gold surface via hydroxyl groups. Hydroxyl group and the amine ligands of GBP seem to percieve the gold surface the structure of atomic lattice on the gold surface. (Tamerler et al., 2006). Thus, the binding pecuriality of GBP can be an useful avenue for protein immobilization on gold substrate, substantially contributing to the biosensor development.
  
 
We created a vector capable of producing the GBP.
 
We created a vector capable of producing the GBP.
Line 11: Line 11:
  
 
GBP F1(Forward) – TCTAGAATGGGAAAAACCCAGGCA
 
GBP F1(Forward) – TCTAGAATGGGAAAAACCCAGGCA
 +
 
GBP R1(Reverse) – ACTAGTAAATTCGGATTGTAT
 
GBP R1(Reverse) – ACTAGTAAATTCGGATTGTAT
  

Revision as of 09:02, 17 October 2018


Gold binding polypeptide (GBP)

Gold binding polypeptide (GBP) can be used as an anchor component, robustly binding to a gold surface and it is consisted of 14 amino acids (MHGKTQATSGTIOS) triplication (Braun, Sarikaya, & Schulten, 2002; Brown, Sarikaya, & Johnson, 2000).

The strong coupling property of GBP onto a gold patterned substrate was delineated in a previous investigation (Tamerler et al., 2006). it is, nevertheless, unclear how GBP binds to the gold substrate (Braun et al., 2002). Intriguingly, Fenter et al. (1994) clarified that the sequences of GBP do not include any cysteine residue leading to a covalent bond with a gold substrate via a thiol linkage. Also, an important role of GBP binding seems to be caused by the polar groups exposed via the amino acids (M, K, T, Q, and S) residues. Considering the concept above, the anitparallel beta-sheet sturcture of GBP might be linked to the gold surface via hydroxyl groups. Hydroxyl group and the amine ligands of GBP seem to percieve the gold surface the structure of atomic lattice on the gold surface. (Tamerler et al., 2006). Thus, the binding pecuriality of GBP can be an useful avenue for protein immobilization on gold substrate, substantially contributing to the biosensor development.

We created a vector capable of producing the GBP. The DNA fragment encoding GBP was obtained by PCR amplification using the primers (GBP F1 and R1) and the plasmid pSB1C3-GBP-ProG as a template. The restriction enzyme sites were underlined.

GBP F1(Forward) – TCTAGAATGGGAAAAACCCAGGCA

GBP R1(Reverse) – ACTAGTAAATTCGGATTGTAT

The PCR product of the GBP-coding fragment was ligated with the TA vector. The ligated vector was digested with XbaI and SpeI restriction enzymes, and then ligated into the enzymes site of pSB1C3 backbone plasmid. We checked appropriate insertion of the fragment in the vector by gel electrophoresis after reaction with XbaI and SpeI to verify the exact band scale. Figure 1 showed that lane 1, 2, 3, is proper orientation producing the GBP.




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]