Difference between revisions of "Part:BBa K2834003"
Danielaolono (Talk | contribs) |
Danielaolono (Talk | contribs) |
||
Line 20: | Line 20: | ||
<p align="justify"> | <p align="justify"> | ||
− | + | In the last few years a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial pepptides isolated from lymph fluid of the adult honeybee that have come to address this necessity. These peptides are composed of 18 residues, being proline the main component. Structurally, apidaecins consist of two regions, the conserved region, responsible for the general antibacterial capacity, and the variable region, responsible for the antibacterial spectrum. | |
<br><br> | <br><br> | ||
Apidaecins222222222222222222222. | Apidaecins222222222222222222222. |
Revision as of 19:14, 14 October 2018
Expressible apidaecin antimicrobial peptide from Apis mellifera
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, apidaecin, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of apidaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTC
Usage and Biology
In the last few years a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial pepptides isolated from lymph fluid of the adult honeybee that have come to address this necessity. These peptides are composed of 18 residues, being proline the main component. Structurally, apidaecins consist of two regions, the conserved region, responsible for the general antibacterial capacity, and the variable region, responsible for the antibacterial spectrum.
Apidaecins222222222222222222222.
Sequence and Features
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]