Difference between revisions of "Part:BBa K2591023"
Line 3: | Line 3: | ||
<partinfo>BBa_K2591023 short</partinfo> | <partinfo>BBa_K2591023 short</partinfo> | ||
− | |||
− | |||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | |||
+ | Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013) | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013) | ||
+ | |||
+ | |||
+ | In our project, we design this gRNA to a nonsense sequence, and this gRNA have no effect on normal activity of the cell, let alone the secretion of the Wnt3A protein. We design this gRNA as a negative control in our project. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | Figure2. Diagram of pSB1C3_gRNA_scaffold. | ||
+ | |||
+ | ===Characterization=== | ||
+ | |||
+ | target length: 20 nt | ||
+ | |||
+ | target sequence: AAAACGGCTCGATCGGTGAT | ||
+ | |||
+ | primer for plasmid construction: | ||
+ | |||
+ | Non-gRNA-F 5' -CACCGAAAACGGCTCGATCGGTGAT- 3' | ||
+ | |||
+ | Non-gRNA-R 5' -AAACATCACCGATCGAGCCGTTTTC- 3' | ||
+ | |||
+ | |||
+ | Location in gene loci: | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | As mentioned above, knockout of Wls will not impair the Wnt3a secretion activity in the cells as a negative control group. Therefore, we first introduce sgWls into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. Validation images are shown in Fig3. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | Figure 4. 293R-TCF-EGFP cell line coculture with the L-Wnt3A-Cas9-mCherry-gRNA_non-target cell line in 24h as a negative group. (a) observe with white light; (b) observe at 475nm; (c) observe at 556nm. We can see the fluorescent protein at the 475nm and 556nm, it means the Wnt3A protein can be secreted from the L cell normally, and the non-target gRNA could not target specific sequence. | ||
+ | |||
+ | |||
<!-- --> | <!-- --> |
Latest revision as of 18:08, 11 October 2018
a no functional gRNA which can not affect the secretion of the Wnt3A protein
Usage and Biology
Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013)
Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013)
In our project, we design this gRNA to a nonsense sequence, and this gRNA have no effect on normal activity of the cell, let alone the secretion of the Wnt3A protein. We design this gRNA as a negative control in our project.
Figure2. Diagram of pSB1C3_gRNA_scaffold.
Characterization
target length: 20 nt
target sequence: AAAACGGCTCGATCGGTGAT
primer for plasmid construction:
Non-gRNA-F 5' -CACCGAAAACGGCTCGATCGGTGAT- 3'
Non-gRNA-R 5' -AAACATCACCGATCGAGCCGTTTTC- 3'
Location in gene loci:
As mentioned above, knockout of Wls will not impair the Wnt3a secretion activity in the cells as a negative control group. Therefore, we first introduce sgWls into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. Validation images are shown in Fig3.
Figure 4. 293R-TCF-EGFP cell line coculture with the L-Wnt3A-Cas9-mCherry-gRNA_non-target cell line in 24h as a negative group. (a) observe with white light; (b) observe at 475nm; (c) observe at 556nm. We can see the fluorescent protein at the 475nm and 556nm, it means the Wnt3A protein can be secreted from the L cell normally, and the non-target gRNA could not target specific sequence.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]