Difference between revisions of "Part:BBa K1592002"
(it's a point mutation in general) |
|||
Line 37: | Line 37: | ||
To find whether sand treated with different Si-tag cells can form cementation with different intensity, column cementation tests were also conducted with MCFP3 cells and different Si-tag cells. Sand treated with all Si-tag cells except wild-type control cells could form a cemented cylinder (Figure 4h). The relative intensity of the cylinders was quantified by the critical pressure value at cementation destruction. The results showed that Si-tag1+2+3 provided the highest cementation intensity, whereas Si-tag2+3 provided medium cementation intensity and the other strains provided weak cementation intensity (Figure 4i). This finding is comparable to the results from the Si-tag silica binding test in which Si-tag1+2+3 cells provided the highest silica binding intensity while other cells provided medium or weak intensity. | To find whether sand treated with different Si-tag cells can form cementation with different intensity, column cementation tests were also conducted with MCFP3 cells and different Si-tag cells. Sand treated with all Si-tag cells except wild-type control cells could form a cemented cylinder (Figure 4h). The relative intensity of the cylinders was quantified by the critical pressure value at cementation destruction. The results showed that Si-tag1+2+3 provided the highest cementation intensity, whereas Si-tag2+3 provided medium cementation intensity and the other strains provided weak cementation intensity (Figure 4i). This finding is comparable to the results from the Si-tag silica binding test in which Si-tag1+2+3 cells provided the highest silica binding intensity while other cells provided medium or weak intensity. | ||
</p> | </p> | ||
+ | |||
Line 45: | Line 46: | ||
<!-- --> | <!-- --> | ||
//it's a point mutation realizeing through PCR. Hence,key point is how to design primer.Primer forward is cgaggccgctgctggtgctcacgccactgccggtgccattg,and reverse is caatggcaccggcagtggcgtgagcaccagcagcggcctcg. source comes from BBa_K863020.It includes PCR,gel extraction and sequencing | //it's a point mutation realizeing through PCR. Hence,key point is how to design primer.Primer forward is cgaggccgctgctggtgctcacgccactgccggtgccattg,and reverse is caatggcaccggcagtggcgtgagcaccagcagcggcctcg. source comes from BBa_K863020.It includes PCR,gel extraction and sequencing | ||
+ | |||
+ | ===Updated Characterization=== | ||
+ | For this part, we have found a point error(T->C), which may potentially causes some unexpected functional damage. Therefore, we intended to fix the point mutation by artificial mutagenesis. The total length of this biobrick, BBa_K1592002, is 366bp, inside which located a point error in No.189bp. So, we decided to utilize PCR to generate mutation. The forward primer(BM2_mut_F) is 5’-cgaggccgctgctggtgctcacgccactgccggtgccattg-3’, and the reverse primer(BM2_mut_R) is 5’-caatggcaccggcagtggcgtgagcaccagcagcggcctcg-3’. | ||
+ | First, we designed the PCR experiment as follows: | ||
+ | plasmid_ BBa_K1592002 2 μL | ||
+ | BM2_mut_F 2μL | ||
+ | BM2_mut_R 2μL | ||
+ | 2×phanta Max Master Mix 25μL | ||
+ | H2O 19μL | ||
+ | Total 50μL | ||
+ | For negative control, the 2×phanta Max Master Mix was replaced by H2O of the same volume. | ||
+ | |||
+ | PCR program was 95°C for 30s, then went to 25 cycles, which included degradation at 95°C for 15s,annealing at 63°C for 15s, extension at 72°C for 2min, then followed by a 5-min 72°C completely extension. Then we run a gel to see whether PCR is successful, which used 5kb marker and 1% gel to run for 30min. Gel image was shown in Fig1. | ||
+ | After that, extraction of DNA sample from gel was done. Then we used DpnI, which cut the methylated GATC sequence, to digest the methylated origin templates and left the newly synthesized DNA. Finally, we directly transformed the digestion product into DH5α, due to the repair system of E.coli, the linearized plasmids was fixed to circular. Then we did miniprep and sent to Sanger sequencing. The sequencing result shown we had successfully generate the point mutation in No.189bp, which means the single error was repaired.(Fig2) | ||
+ | |||
+ | |||
+ | Figure1. Linearization PCR results of Plasmid_BBa_I714031. First lane: Marker. Second lane: experimental group. Third lane: negative control(NO enzyme) | ||
+ | |||
+ | Figure2. Alignment of mutagenesis product and original sequence. |
Revision as of 07:53, 13 October 2018
Yarrowia lipolytica cell wall protein 3
The covalently bound GPI-anchored cell wall protein of Y. lipolytica Ylcwp1 has been isolated and characterized (Jaafar and Zueco 2004). The nucleotide sequence encoding 110 amino acids of the Ylcwp1 C terminus has been utilized for the construction of the cell surface display vector in Y. lipolytica (Yue et al. 2008). This system was successfully used to immobilize green fluorescent protein (Yue et al. 2008). The ability of five new putative covalently linked cell wall proteins of Y. lipolytica -Ylcwp1, Ylcwp2, Ylcwp3, Ylcwp4, Ylcwp5, was tested and the highest cell-bound lipase value was obtained with the anchor domains Ylcwp3 (Evgeniya et al. 2011), so we utilized the YLcwp3 for the cell surface display in Y. lipolytica.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 14
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 35
Characterization
As an anchor domain, YLcwp3 is the component of the cell surface display system of Yarrowia lipolytica.
Verification of cell surface display system
We used the fluorescence immunoassay to verify the success of cell surface display system. We had added the DNA sequence of 6xhis tag between the signal peptide and our silica-tag protein when constructing JMP62 plasmid, so that the 6xhis tag could be fusion expressed with the silica-tag protein and displayed on cell surface together. While the signal peptide could be cut out during the secretion. When we used the fluorescence immunoassay anti 6xhis tag, the primary antibody (mouse anti 6xhis tag) and the secondary antibody (FITC tagged goat anti-mouse IgG) detected 6xHis tagged Si-tag protein on cell surface.
Figure 2 shows the result of our verification of cell surface display system. The fluorescence surrounding cell wall shows that we succeed in displaying the silica-tag protein onto the cell surface, which means YLcwp3 successfully anchor on the cell wall and display the interest protein outside of cell. For the limit of experimental conditions, we can not get a thorough fluorescence staining. Some cells can show a considerable flourescencent intensity, while some performs partial or weak flourescence which can not be detected by our microscope camera.
Improvement
HUST-China 2015 put up an original method to cement sands as a promising way to help build firm structure in marine environment. The project “Euk.cement” was nominated “Best Environment Project” and “Best New Basic Part”. After the Jamboree, HUST-China iGEMers stepped forward--We did more part characterizations and achieved more valid data to submit to the registry. What’s more exciting is that we successfully published a paper “A living eukaryotic auto-cementation kit from surface display of silica binding peptides on Yarrowia lipolytica” on ACS Synthetic Biology (IF 6.076). We will demonstrate our working details in the following:
Sand cementation function
Last year, because of the limited time, we only tested sand cementation function of the ST123-JMY1212&mcfp3-JMY1212 mixed cells. It showed obvious effect on cementing sands. To make the data valid, this year, we together characterized 8 combinations of Si-tag domains and MCFP3 producing cells, and the results were quite corresponding to our expectation. The cementation test verified the cooperation of immobilization system and flocculation system cells in actual application conditions. Quartz sand (40 grams) mixed with either Si-tag+MCFP3 YMY1212 cells or control wild-type cells was loaded into a glass column, and a solution carrying oxygen, calcium and culture nutrients was supplied into the column using a peristaltic pump (Figure 4a). After 24 hours of treatment, the sand columns were dehydrated in a drying oven and then removed from the glass column. The sand treated with control wild-type JMY1212 cells was still scattered; only a few small clumps could be identified (Figure 4 c), and these may have been induced by the constitutive respiration of the wild type cells. However, with the treatment of Si-tag+MCFP3 cells, the sand aggregated, and an intact solid sand cylinder was obtained (Figure 4b). With further comparison of the treated sand under a microscope, the quartz sand granules treated with Si-tag+MCFP3 cells were found to be tightly agglutinated, whereas the quartz sand granules treated with wild type cells remained dispersed (Figure 4 d, e).
These results indicated that Si-tag+MCFP3 cells actually worked well at making silica particles form a certain intact structure, which fits our hypothesis and design of their cementation function. It was also noticed in the cementation test that there were some small holes in the cemented sand cylinder. This special porous structure indicated the balance between the CO2 released from cell respiration and the calcium/magnesium sedimentation caused by the released CO2. This sedimentation, however, will be the final and vital step of the cementation process. Indeed, in some cementation applications, this structure is very important. For example, in desert sand consolidation treatment, this multi-porous structure will eliminate the potential compaction risk and will enable organisms to grow on it; in artificial reef construction on aqua farms, the multi-porous structure could also offer niches to all types of marine life.
To mimic the real conditions in underwater applications, we also tested the sand cementation under the condition of high water-to-sand ratio with turbulence in flasks on a shaker. Compared to sand treated with wild-type cells, sand treated with Si-tag cells and MCFP3 cells was found to be cemented together tightly using microscopy (Figure 4f, g). To find whether sand treated with different Si-tag cells can form cementation with different intensity, column cementation tests were also conducted with MCFP3 cells and different Si-tag cells. Sand treated with all Si-tag cells except wild-type control cells could form a cemented cylinder (Figure 4h). The relative intensity of the cylinders was quantified by the critical pressure value at cementation destruction. The results showed that Si-tag1+2+3 provided the highest cementation intensity, whereas Si-tag2+3 provided medium cementation intensity and the other strains provided weak cementation intensity (Figure 4i). This finding is comparable to the results from the Si-tag silica binding test in which Si-tag1+2+3 cells provided the highest silica binding intensity while other cells provided medium or weak intensity.
//it's a point mutation realizeing through PCR. Hence,key point is how to design primer.Primer forward is cgaggccgctgctggtgctcacgccactgccggtgccattg,and reverse is caatggcaccggcagtggcgtgagcaccagcagcggcctcg. source comes from BBa_K863020.It includes PCR,gel extraction and sequencing
Updated Characterization
For this part, we have found a point error(T->C), which may potentially causes some unexpected functional damage. Therefore, we intended to fix the point mutation by artificial mutagenesis. The total length of this biobrick, BBa_K1592002, is 366bp, inside which located a point error in No.189bp. So, we decided to utilize PCR to generate mutation. The forward primer(BM2_mut_F) is 5’-cgaggccgctgctggtgctcacgccactgccggtgccattg-3’, and the reverse primer(BM2_mut_R) is 5’-caatggcaccggcagtggcgtgagcaccagcagcggcctcg-3’. First, we designed the PCR experiment as follows: plasmid_ BBa_K1592002 2 μL BM2_mut_F 2μL BM2_mut_R 2μL 2×phanta Max Master Mix 25μL H2O 19μL Total 50μL For negative control, the 2×phanta Max Master Mix was replaced by H2O of the same volume.
PCR program was 95°C for 30s, then went to 25 cycles, which included degradation at 95°C for 15s,annealing at 63°C for 15s, extension at 72°C for 2min, then followed by a 5-min 72°C completely extension. Then we run a gel to see whether PCR is successful, which used 5kb marker and 1% gel to run for 30min. Gel image was shown in Fig1. After that, extraction of DNA sample from gel was done. Then we used DpnI, which cut the methylated GATC sequence, to digest the methylated origin templates and left the newly synthesized DNA. Finally, we directly transformed the digestion product into DH5α, due to the repair system of E.coli, the linearized plasmids was fixed to circular. Then we did miniprep and sent to Sanger sequencing. The sequencing result shown we had successfully generate the point mutation in No.189bp, which means the single error was repaired.(Fig2)
Figure1. Linearization PCR results of Plasmid_BBa_I714031. First lane: Marker. Second lane: experimental group. Third lane: negative control(NO enzyme)
Figure2. Alignment of mutagenesis product and original sequence.