Difference between revisions of "Part:BBa K2298000"

Revision as of 18:18, 1 November 2017

Human basic fibroblast growth factor (bFGF)

Figure 1: Plasmid map of pSB1C3-bFGF

Biology and Usage

Fibroblast growth factors(FGFs), originally known for their capability of promoting fibroblast proliferation, are a family of growth factors that has shown great potentials on tissue repair. Human FGFs consist of 22 members. FGFs exert their roles by binding to the transmembrane tyrosine kinase receptors, FGF receptors(FGFRs), therefore triggering downstream signaling cascades including RAS/MAP Kinase pathway, PI3 Kinase/AKT pathway and PLC-gamma pathway. The signaling then stimulates a wide range of cellular responses, such as cell proliferation, cell migration, cell differentiation and angiogenesis. (see review【1】)

Due to the ability to induce fibroblast proliferation and angiogenesis, FGFs have been studied extensively in terms of tissue repair in diverse kinds of tissue, with basic fibroblast growth factor(bFGF) being the most used FGF in wound healing(see review【1】). bFGF is thought to be an initiator of the wound healing process, reaching its highest concentration soon after injury and then declining to serum level【2】. bFGF may also possess the anti-scarring effect during wound healing【3】, which makes it an potential candidate for scar-free healing applications.

Figure 2: Schematic demonstration of the signaling cascades of FGFs, adapted from reference【1】

Design Considerations

The nucleotide sequence of bFGF mRNA was retrieved from NCBI nucleotide database(NCBI Reference Sequence: NM_002006.4:465-932), and synthesized by IGE Biotechnology LTD. Biobrick prefix and suffix was added by PCR using the following primers,

bFGF prefix: 5’ CGGAATTCGCGGCCGCTTCTAGACCATGGCAGCCGGGA 3’

bFGF suffix: 5’ AACTGCAGCGGCCGCTACTAGTAGATCCCGTTGCAACCGC 3’

and ligated onto the pSB1C3 plasmid backbone obtained from digestion of interlab test device 1(BBa_J364000). The ligation was verified by PCR using VF2 and VR as primers, and was further comfirmed by Sanger sequencing by IGE Biotechnology LTD using VF2 as the forward primer.

Figure 3: Gel analysis result of pSB1C3-bFGF, using VF2 and VR as primers

Figure 4: Sequencing result of pSB1C3-bFGF, using VF2 as primer

Note that this part comes in the absence of the stop codon at the end of the sequence, hence this part should be cloned into vectors with pre-existing stop codon, fused with other protein with stop codon, or added a stop codon using PCR prior to use. Although this sequence start with ACC instead of a canonical start codon ATG, the starting A can still form a complete XbaI site with BioBrick prefix for coding sequence.

2-step PCR

When it comes to constructing BioBricks, it is essential to add both BioBrick prefix and suffix However, both prefix and suffix is 22bp in length with high GC content, resulting in primers over 40bp in length, accompanied by extremely high Tm value. PCR reactions with such primers are likely to yield no intended products. Last year, the team SYSU-CHINA proposed to use shorter primers with only XbaI and SpeI restriction sites to solve this problem. However, XbaI and SpeI have compatible sticky ends which may result in uncontrolable orientation of the insertion as well as vector self-ligation (unless treated with alkaline phosphatase).

This year, we propose an alternative PCR protocol called 2-step PCR (there are only 2 steps each cycle) to solve this problem. This method is adapted from Takara PrimerSTAR Max DNA Polymerase product manual with slight alternation. The set-up is shown below:

For the reaction mixture:

 DNA template: 200-300ng/50ul

 Forward primer: 20pmol

 Reverse primer: 20pmol

 PrimeSTAR Max Premix（2×): 25ul 

 DdH2O: up to 50ul

For the reaction condition set-up:

Pre-denaturalization

 98 degree celcius for 3minutes

Amplification cycles

 95 degree celcius for 30 seconds

 68 degree celcius for 60 seconds

 Repeat for 30 cycles

Final elongation

 72 degree celcius for 3 minutes

Using this method, we successfully added prefix and suffix to the bFGF gene and ligate the product to pSB1C3 backbone with ease.

Figure 4: Gel electrophoresis result of bFGF amplification using 2-step PCR

Note that this method may yield unspecific amplification, thus agarose gel electrophoresis and gel extraction should be performed to obtain amplification products of right size. Moreover, additional experiments are required to determine the optimal parameters for this PCR reaction.

Results

For more details, please check out our [http://2017.igem.org/Team:SYSU-CHINA#/Demonstrate result page]!

In iGEM 2017, SYSU-CHINA constructed the circuit in which bFGF was fused to eGFP as well as 3xFLAG tags and expressed under the control of CMV promoter. Bone marrow stromal cells (BMSCs) were infected the with lentivirus containing the circuit and selected using puromycin. The transcription was measured using quantative PCR.

Figure 5: qPCR result

The transgenic BMSCs was cultured for 48 hours and the supernatant, theoratically containing certain growth factors, was collected. Scratch wound healing assays were performed using HEK293T cells with the collected supernatant. The data below suggested that bFGF (in concert with other soluable factors) produced by transgenic BMSCs is able to accelerate wound healing.

Figure 6: Results of scratch wound healing assays

To further demonstrate the potentials of the bFGF-transgenic BMSCs, Collected supernatant mentioned above was used to culture uterine endometrium cells, and MTT assay were performed after 48 hours. The result indicated that bFGF secreted by engineered BMSCs is able to promote endometrium cell growth.

Figure 7: Results of MTT assays

References

1 Yun, Y. R. et al. Fibroblast growth factors: biology, function, and application for tissue regeneration. Journal of tissue engineering 2010, 218142, doi:10.4061/2010/218142 (2010).

2 Nissen, N. N. et al. Vascular endothelial growth factor mediates angiogenic activity during the proliferative phase of wound healing. The American journal of pathology 152, 1445-1452 (1998).

3 Spyrou, G. E. & Naylor, I. L. The effect of basic fibroblast growth factor on scarring. British journal of plastic surgery 55, 275-282 (2002).

Sequence and Features