Difference between revisions of "Part:BBa K2273111"
Line 25: | Line 25: | ||
<p>Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous Beta-lactam biosensor in <i>Bacillus subtilis</i>. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.</p> | <p>Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous Beta-lactam biosensor in <i>Bacillus subtilis</i>. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.</p> | ||
− | |||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
− | In the context of our Project EncaBcillus we developed several functional Biosensor strains in <i>Bacillus subtilis</i> that are based on the <i>bla</i> operon from <i>Staphylococcus aureus</i> | + | |
+ | <p>In the context of our Project EncaBcillus we developed several functional Biosensor strains in <i>Bacillus subtilis</i> that are based on the <i>bla</i> operon from <i>Staphylococcus aureus</i></p> | ||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> |
Revision as of 17:25, 30 October 2017
PblaZ Promoter controlling gene expression of blaZ in S. aureus
The PblaZ promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
This part is a composite of the bla operon found in Staphylococcus aureus and constitutes the promoter regulating gene expression of the gene blaZ, coding for a beta-lactamase. If the microorganism is exposed to beta-lactam antibiotics, a receptor, named blaR1 [1], senses the compound and a signal is transduced into the cytoplasm. Subsequently, the BlaI repressor protein [2] is degraded and frees the PblaZ promoter. Following, the blaZ gene is transcribed and confers resistance to the antibiotic.
This part features the RFC10 prefix and suffix:
Prefix with | EcoRI, NotI, XbaI | GAATTCGCGGCCGCTTCTAGA |
Suffix with | SpeI, NotI and PstI | ACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)
Beta-Lactam Biosensor
Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous Beta-lactam biosensor in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.
Usage and Biology
In the context of our Project EncaBcillus we developed several functional Biosensor strains in Bacillus subtilis that are based on the bla operon from Staphylococcus aureus
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]