Difference between revisions of "Part:BBa K2254000"
Line 23: Line 23:
 
We tested our toehold switch cloning tool when constructing our SAT switch. We ordered a pair of 60nt oligoes when constructing switch-expressing plasmid. The complementary oligoes were mixed to give dsDNA insert with sticky end. The dsDNA was then ligated to Eco31I digested plasmid. Ligation product was transformed to E. coli DH5a competent cells. Below showed the plate of E. coli cell transformed with SAT switch-oligoes-ligation product viewed under blue light:
 
We tested our toehold switch cloning tool when constructing our SAT switch. We ordered a pair of 60nt oligoes when constructing switch-expressing plasmid. The complementary oligoes were mixed to give dsDNA insert with sticky end. The dsDNA was then ligated to Eco31I digested plasmid. Ligation product was transformed to E. coli DH5a competent cells. Below showed the plate of E. coli cell transformed with SAT switch-oligoes-ligation product viewed under blue light:
 
<br>
 
<br>
−
<center><img src="https://static.igem.org/mediawiki/2017/7/72/CUHK_toolresult.jpg" width="50%" height="auto"></center>
+
<center><img src="https://static.igem.org/mediawiki/parts/f/f2/CUHK_SSDClone.jpg" width="50%" height="auto"></center>
 
<br>
 
<br>
−
We can observed that there were fluorescent colonies and non- fluorescent colonies on each plate. The black arrows point to 3 non- fluorescent colonies. Since fluorescent colonies are probably resulted by self-ligated plasmid, we picked the non- fluorescent colonies to sequence. Sequencing result showed that the switch and trigger were successfully inserted. This proved that our tools worked as expected and provide a convenient way for construction of switch-expressing plasmid and trigger-expressing plasmid.
+
We can observed that there were fluorescent colonies and non- fluorescent colonies on plate. The black arrows point to 3 non- fluorescent colonies. Since fluorescent colonies are probably resulted by self-ligated plasmid, we picked the non- fluorescent colonies to sequence. Sequencing result showed that the switch were successfully inserted. This proved that our tools worked as expected and provide a convenient way for construction of switch-expressing plasmid.
  
  

Revision as of 18:13, 29 October 2017

No part name specified with partinfo tag.

Usage and Biology

The toehold switch cloning tool is a part used by Hong Kong-CUHK 2017 team for convenient cloning and validation of toehold switch that detect specific sequence of RNA. After designing toehold switch in silico, user can insert the switch into the part by Eco31I digestion followed by ligation.

To obtain the toehold switch insert, user can mix 2 DNA oligos (about 60nt): one oligo contains forward toehold switch sequence with AGGG at 5’ end, and one oligo contains reverse complement toehold switch sequence with AGTA at 5’ end. To allow convenient screening of correct clone, double digestion by Eco31I will remove the constitutive promoter (J23100), and insertion of switch will block the translation of mRFP, resulting colonies that don’t express mRFP, whereas ligation of single digested plasmid will give red colonies.

The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an Xhoi site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.

The Part

Characterisation

Characterisation:


Restriction mapping by XhoI and PstI showed correct insertion of our cloning tool into respective backbones pSB4C5, Eco31I could also digest the switch and trigger cloning tool. Below shows the 1% agarose gel:

<img src="CUHK_SSDGel2.jpg" width="50%" height="auto">


We tested our toehold switch cloning tool when constructing our SAT switch. We ordered a pair of 60nt oligoes when constructing switch-expressing plasmid. The complementary oligoes were mixed to give dsDNA insert with sticky end. The dsDNA was then ligated to Eco31I digested plasmid. Ligation product was transformed to E. coli DH5a competent cells. Below showed the plate of E. coli cell transformed with SAT switch-oligoes-ligation product viewed under blue light:

<img src="CUHK_SSDClone.jpg" width="50%" height="auto">


We can observed that there were fluorescent colonies and non- fluorescent colonies on plate. The black arrows point to 3 non- fluorescent colonies. Since fluorescent colonies are probably resulted by self-ligated plasmid, we picked the non- fluorescent colonies to sequence. Sequencing result showed that the switch were successfully inserted. This proved that our tools worked as expected and provide a convenient way for construction of switch-expressing plasmid.








Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 34
    Illegal NheI site found at 57
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 120
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 680
    Illegal AgeI site found at 792
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 92
    Illegal BsaI.rc site found at 22


Functional Parameters

No part name specified with partinfo tag.