Difference between revisions of "Part:BBa K2342007"
Line 7: | Line 7: | ||
Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. | Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. | ||
For further detailed documentation of part usage, function and validation, see following sections below. | For further detailed documentation of part usage, function and validation, see following sections below. | ||
+ | |||
+ | Promoter information | ||
+ | |||
+ | |||
+ | The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual: https://research.fhcrc.org/content/dam/stripe/hahn/methods/biochem/pet.pdf ) | ||
+ | |||
+ | [[File:BBa_K2342007_Figure_1_aaltohelsinki9.png|600px|thumb|center|alt text]] | ||
+ | Sequencing results | ||
+ | |||
+ | [[File:File.png|200px|thumb|left|alt text]] | ||
+ | The sequences of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct. | ||
+ | |||
Revision as of 09:37, 28 October 2017
DCD1L peptide linked to a CBM with a 22 AA linker
Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other know AMPs. (2) It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. (3) Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD1 and DCD1L. DCD1L is one of the most abundant form of dermcidin derived peptide. DCD1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes. (2,6) Although the precise mode of action is not entirely explored, it is thought that DCD1L hexamers form pores on bacterial membrane leading to cell death. (5) Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of 6XHis-Smt3 tag is used for expression and purification. (4) 6xHis tag in N-terminus is used for purification with immobilized metal ion affinity chromatography (IMAC) columns designed for histidine tagged proteins. Employing of Smt3 tag is beneficial in several aspects in our project. Ulp1 enzyme is able to cleavage fusion peptide by recognizing Smt3. Smt3 tag keeps antimicrobial peptide in inactivation form so that the peptide is not toxic to production host, by blocking its adhesion due to relatively large size of His-Smt3 tag. Smt3 tag Another advantage of using Smt3 is due to its effect on solubility and preventing inclusion bodies of fusion peptide significantly easing purification step. Finally, it facilitated easier detect of the peptide with a conventional method, SDS-PAGE. Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. For further detailed documentation of part usage, function and validation, see following sections below.
Promoter information
The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual: https://research.fhcrc.org/content/dam/stripe/hahn/methods/biochem/pet.pdf )
Sequencing results
The sequences of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 127
Illegal BglII site found at 410 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]