Revision as of 17:59, 26 October 2017

Introduction

P_fus(6 Ste12 binding sites)

General

The original P_fus (BBa_K1154001) is 249bp long with three Ste12 binding sites, and the Ste12 is the P_fus of transcriptional activator in the endogenous GPCR pathways of yeast.

Fig.1 The sequence of original P_fus

In order to enhance the transcription initiation activity of the promoter, we added additional three binding sites (gatgaaacaaacatgtct gtaatttgaaacacgcgctgtctca) in the front of the promoter.

Fig.2 Sequencing result of original P_fus and mutant P_fus

After the modified promoter assembling into the [http://2017.igem.org/Team:BIT-China/Project/#Detection detection circuit], we added 5umol/L α pheromone to detect it, and the result is shown in Fig.3.

Fig.3 The mRFP intensity of two kinds of promoters

The intensity of modified promoter was about 1/2 of the wild type, which didn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there were serious limitations in Ste12 multimers identifying Ste12 binding sites. So when we changed the structure of P_fus , the steric hindrance of Ste12 may increases and Ste12 couldn’t combine the promoter as smoothly as before.

But from another point of view, still, we got the new P_fus with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.

This part is an improvement of BBa_K1154001 of 2013 RHIT team.

[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x

Sequence and Features