Revision as of 10:15, 26 October 2017 (view source) Bitlichun (Talk | contribs) (→‎Applications of BBa_K1154001) ← Older edit		Revision as of 10:16, 26 October 2017 (view source) Bitlichun (Talk | contribs) (→‎Applications of BBa_K1154001) Newer edit →
Line 73:		Line 73:
	<br />		<br />
	__NOTOC__		__NOTOC__
−	<h1>Introduction</h1>	+
	<partinfo>BBa_K2368027 short</partinfo>		<partinfo>BBa_K2368027 short</partinfo>
	<h3>General</h3>		<h3>General</h3>

---

Revision as of 10:16, 26 October 2017

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1154001

We decreased the transcription initiation activity of the promoter and changed the sequence of P_fus

Introduction

P_fus(2 Ste12 binding sites)

General

The original P_fus (BBa_K1154001) is 201bp long with three Ste12 binding sites, and the Ste12 is P_fus’s transcriptional activator in the endogenous GPCR pathways of yeast.

Fig.1 The sequence of original P_fus

In order to decrease the transcription initiation activity of the promoter, we used the method of one-step mutation to remove a binding sites. (from tgaaaca to ggacac)

Fig.2 Sequencing result of original P_fus and mutant P_fus

After the modified promoter assembling into the [http://2017.igem.org/Team:BIT-China/Project/#Detection detection circuit], we added 5umol/L α pheromone to detect it, and the result is shown in Fig.3.

Fig.3 The mRFP intensity of two kinds of promoters

The intensity of modified promoter was about 35% of the wild type, which did match with our expectation. We got the new Pfus with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.

But from another point of view, still, we got the new P_fus with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.

This part is an improvement of BBa_K1154001 of 2013 RHIT team.

Introduction

P_fus(4 Ste12 binding sites)

General

The original P_fus (BBa_K1154001) is 201bp long with three Ste12 binding sites, and the Ste12 is P_fus’s transcriptional activator in the endogenous GPCR pathways of yeast.

Fig.1 The sequence of original P_fus

In order to enhance the transcription initiation activity of the promoter, we add additional one binding site(gatgaaacaa) in the front of the promoter.

Fig.2 Sequencing result of original P_fus and mutant P_fus

After the modified promoter assembling into the [http://2017.igem.org/Team:BIT-China/Project/#Detection detection circuit], we added 5umol/L α pheromone to detect it, and the result is shown in Fig.3.

Fig.3 The mRFP intensity of two kinds of promoters

The intensity of modified promoter was about 1/3 of the wild type, which didn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there were serious limitations in Ste12 multimers identifying Ste12 binding sites. So when we changed the structure of P_fus, the steric hindrance of Ste12 may increases and Ste12 couldn’t combine the promoter as smoothly as before.

But from another point of view, still, we got the new P_fus with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.

This part is an improvement of BBa_K1154001 of 2013 RHIT team.

P_fus(6 Ste12 binding sites)

General

The original P_fus (BBa_K1154001) is 201bp long with three STE12 binding sites, and the STE12 is P_fus ’s transcriptional activator in the endogenous GPCR pathways of yeast.

Fig.1 The sequence of original P_fus

In order to enhance the transcription initiation activity of the promoter, we added additional three binding sites (gatgaaacaaacatgtct gtaatttgaaacacgcgctgtctca) in the front of the promoter.

Fig.2 Sequencing result of original P_fus and mutant P_fus

After the modified promoter assembling into the [http://2017.igem.org/Team:BIT-China/Project/#Detection detection circuit], we added 5umol/L α pheromone to detect it, and the result is shown in Fig.3.

Fig.3 The mRFP intensity of two kinds of promoters

The intensity of modified promoter was about 1/2 of the wild type, which didn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there were serious limitations in Ste12 multimers identifying Ste12 binding sites. So when we changed the structure of P_fus , the steric hindrance of Ste12 may increases and Ste12 couldn’t combine the promoter as smoothly as before.

But from another point of view, still, we got the new P_fus with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.

This part is an improvement of BBa_K1154001 of 2013 RHIT team.

[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x

User Reviews

UNIQ5f32ac14a795a8b5-partinfo-00000003-QINU UNIQ5f32ac14a795a8b5-partinfo-00000004-QINU