Difference between revisions of "Part:BBa K2368027"
Line 2: Line 2:
 
<h1>Introduction</h1>
 
<h1>Introduction</h1>
 
<partinfo>BBa_K2368027 short</partinfo>
 
<partinfo>BBa_K2368027 short</partinfo>
 +
<h3>General</h3>
 +
<p>The original Pfus (BBa_K1154001) is 201bp long with three STE12 binding sites, and the STE12 is Pfus’s transcriptional activator in the endogenous GPCR pathways of yeast.</p>
 +
<p>In order to enhance the transcription initiation activity of the promoter, we add additional three binding sites(gatgaaacaaacatgaaacgtctgtaatttgaaaca) in the front of the promoter. And we add 5umol/L α pheromone to detect the modified promoter, and the result is shown in fig.2.</p>
 +
<p>The intensity of modified promoter is about 1/2 of the wild type, which doesn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there are serious limitations in STE12 multimers identifying STE12 binding sites. So when we change the structure of Pfus, the steric hindrance of STE12 may increases and STE12 can't combine the promoter as smoothly as before.</p>
  
−
<p>The original Pfus is 213bp long with three STE12 binding sites, which are Pfus’s transcriptional activator in the endogenous GPCR pathways of yeast.</p>
+
<p>But from another point of view, still, we get the new Pfus with different transcription initiation activity. </p>
−
<p>In order to enhance the transcription initiation activity of the promoter, we add additional three binding sites in front of the promoter. </p>
+
<h3>Reference</h3>
−
<p>To detect the activity of the promoter, we link the modified promoter(249bp) to the reporter gene RFP, And transform this line into S.cerevisiae, Cen.PK2-1C(a type).</p>
+
<p>[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x</p>
−
<p>Compared with the original Pfus, we can see that ……</p>
+
  
  

Revision as of 03:56, 14 October 2017

Introduction

Pfus(6 Ste12 binding sites)

General

The original Pfus (BBa_K1154001) is 201bp long with three STE12 binding sites, and the STE12 is Pfus’s transcriptional activator in the endogenous GPCR pathways of yeast.

In order to enhance the transcription initiation activity of the promoter, we add additional three binding sites(gatgaaacaaacatgaaacgtctgtaatttgaaaca) in the front of the promoter. And we add 5umol/L α pheromone to detect the modified promoter, and the result is shown in fig.2.

The intensity of modified promoter is about 1/2 of the wild type, which doesn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there are serious limitations in STE12 multimers identifying STE12 binding sites. So when we change the structure of Pfus, the steric hindrance of STE12 may increases and STE12 can't combine the promoter as smoothly as before.

But from another point of view, still, we get the new Pfus with different transcription initiation activity.

Reference

[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]