Difference between revisions of "Part:BBa K2273112"
Line 23: Line 23:
  
 
===Beta-Lactam Biosensor===
 
===Beta-Lactam Biosensor===
−
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in <i>Bacillus subtilis</i>. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.  
+
Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in <i>Bacillus subtilis</i>. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.
  
  
−
<!-- Add more about the biology of this part here
+
===Assessing Promoter Activity via Plate Reader===
−
===Usage and Biology===
+
This promoter was evaluated in the context of our [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor beta-lactam biosensor] created in the EncaBcillus project. The following graphs show the promoter activity of P<sub><i>blaR1I</sub></i> when the BlaR1I-System was induced with six different beta-lactam antibiotics (ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin, penicillin G and two controls (bacitracin, water).
−
 
+
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>

Revision as of 22:34, 31 October 2017


PblaR1I Promoter found in Staphylococcus aureus

The promoter PblaR1I is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].

This part is a composite of the bla operon found in Staphylococcus aureus and constitutes the promoter regulating gene expression of the genes blaR1 and blaI, encoding a beta-lactam receptor and a repressor protein regulating gene expression of the bla operon. If the microorganism is exposed to beta-lactam antibiotics, the receptor blaR1 [1] senses the compound and a signal is transduced into the cytoplasm. Subsequently, the BlaI repressor protein [2] is degraded and frees the PblaR1I as well as the PblaZ [3] promoter. Following, the genes blaI, blaR1 and blaZ are transcribed and the beta-lactamase blaZ confers resistance to the antibiotic.

This part features the RFC10 prefix and suffix:

Prefix with EcoRI, NotI, XbaI GAATTCGCGGCCGCTTCTAGA
Suffix with SpeI, NotI and PstI ACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)

Beta-Lactam Biosensor

Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.


Assessing Promoter Activity via Plate Reader

This promoter was evaluated in the context of our [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor beta-lactam biosensor] created in the EncaBcillus project. The following graphs show the promoter activity of PblaR1I</sub> when the BlaR1I-System was induced with six different beta-lactam antibiotics (ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin, penicillin G and two controls (bacitracin, water). Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]