Difference between revisions of "Part:BBa K2136016"
Line 35: | Line 35: | ||
Image 1: Gel electrophoresis of mCherry | Image 1: Gel electrophoresis of mCherry | ||
− | After ligating the sequence in the pJP22, we wanted to find the best way to transform C. reinhardtii, we tested Sapphire Blue, TAP medium and water as buffers during the electroporation. Then, cells were plated in Agar-TAP medium Petri dishes with different concentrations of Zeocin (an antibiotic from Bleomycin family) because the plasmid used had a sequence for Bleomycin resistance. | + | <html>After ligating the sequence in the pJP22, we wanted to find the best way to transform C. reinhardtii, we tested Sapphire Blue, TAP medium and water as buffers during the electroporation. Then, cells were plated in Agar-TAP medium Petri dishes with different concentrations of Zeocin (an antibiotic from Bleomycin family) because the plasmid used had a sequence for Bleomycin resistance. |
− | + | <p>After 7 days we selected clones from previous dishes and started new cultures in a 96 well plate with 200 uL of TAP medium per well, agitation of 800 rpm, 25°C +- 1°C and 80 μE m−2 s−1 luminosity and a clear film sealing the plate. We also filled some wells with wild C. reinhardtii, just TAP medium or just mCherry as controls.</p> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | <p> | + | |
− | After 7 days we selected clones from previous dishes and started new cultures in a 96 well plate with 200 uL of TAP medium per well, agitation of 800 rpm, 25°C +- 1°C and 80 μE m−2 s−1 luminosity and a clear film sealing the plate. We also filled some wells with wild C. reinhardtii, just TAP medium or just mCherry as controls.</p> | + | |
<br><img src="https://static.igem.org/mediawiki/2016/8/88/T--USP_UNIFESP-Brazil--mCherry_screening.png" width=600px><br> | <br><img src="https://static.igem.org/mediawiki/2016/8/88/T--USP_UNIFESP-Brazil--mCherry_screening.png" width=600px><br> | ||
Figure 10: Cultivation setup for screening<br> | Figure 10: Cultivation setup for screening<br> | ||
Line 70: | Line 56: | ||
<img src="https://static.igem.org/mediawiki/2016/4/48/T--USP_UNIFESP-Brazil--mCherry_lasermcherry.jpeg" width=400px> | <img src="https://static.igem.org/mediawiki/2016/4/48/T--USP_UNIFESP-Brazil--mCherry_lasermcherry.jpeg" width=400px> | ||
<p>Figure 15: Laser passing through cellular supernatant. On the left laser is passing through a wild type C. reinhardtii supernatant. On the right it's passing through a transformed C. reinhardtii producing mCherry.</p> | <p>Figure 15: Laser passing through cellular supernatant. On the left laser is passing through a wild type C. reinhardtii supernatant. On the right it's passing through a transformed C. reinhardtii producing mCherry.</p> | ||
+ | </html> |
Revision as of 05:09, 19 October 2016
Description
mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1]. The codon optimized mCherry for Chlamydomonas reinhardtii comes from the biobrick BBa_J06504 and it was improved to work specially with C. reinhardtii, a microscopic algae used as model organism to study photosynthesis, cellular division, flagellar biogenesis, and, more recently, mitochondrial function [2]. Our team used this codon optimized mCherry to test the promoter activity and the expression capacity of the our new plasmid for microalgae transformation gBlock1 ([Part:BBa_K2136010]] ) .
Methods
Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation[REF]. So here are the changes that we made in the DNA sequence using the software GeneArt from Life Technologies:
Before Optimization | After Optimization |
---|---|
ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCTTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAATAA | ATGGTGTCCAAGGGCGAGGAGGACAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCAGCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCATGTACGGCAGCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACCTGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTCCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCAGCAGCGAGCGCATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGCGCCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTGAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTGAACATCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCTGAGGGCCGCCACAGCACCGGCGGCATGGACGAGCTGTACAAGTAA |
Image 3 - : Gel electrophoresis of mCherry+pSB1C3 construct
Image 1: Gel electrophoresis of mCherryAfter ligating the sequence in the pJP22, we wanted to find the best way to transform C. reinhardtii, we tested Sapphire Blue, TAP medium and water as buffers during the electroporation. Then, cells were plated in Agar-TAP medium Petri dishes with different concentrations of Zeocin (an antibiotic from Bleomycin family) because the plasmid used had a sequence for Bleomycin resistance.
After 7 days we selected clones from previous dishes and started new cultures in a 96 well plate with 200 uL of TAP medium per well, agitation of 800 rpm, 25°C +- 1°C and 80 μE m−2 s−1 luminosity and a clear film sealing the plate. We also filled some wells with wild C. reinhardtii, just TAP medium or just mCherry as controls.
Figure 10: Cultivation setup for screening
For a better characterization of mCherry we’ve measured its excitation and emission spectra using a Tecan M200 Pro Microplate reader. In the 96 well plate we’ve measured the excitation and emission spectra of transformed C. reinhardtii supernatant, wild C. reinhardtii supernatant, water, TAP medium, transformed C. reinhardtii with spent TAP, wild C. reinhardtii with spent TAP, washed transformed C. reinhardtii with fresh TAP and washed wild C. reinhardtii with fresh TAP. For mCherry fluorescence detection we used excitation wavelength at 575 nm and emission at 608 nm, for inactive mCherry we used excitation wavelength at 410 nm and emission at 461, for Chlorophyll fluorescence we used 440 nm for excitation and 680 nm for emission. We also measured the absorbance at 750 nm for cellular concentration.
The TOP 5 mCherry-producer clones were E 10, which was transformed with TAP medium, and B1, B5, B6 and B11, which were transformed with Sapphire Blue as can be seen in Figure 11.Figure 11: TOP 5 mCherry producers
Before purifying we wanted to see by our own eyes that mCherry was present in the solution. For that, we made the following qualitative analysis:
Figure 13: Experimental setup for qualitative detection of mCherry.
This special filter is able to block the laser light and at the same time allows the light emitted by mCherry to pass through it, as shown in Figure 14.
Image 14: Spectra of experimental setup components
Our results are shown below in Figures 15
Figure 15: Laser passing through cellular supernatant. On the left laser is passing through a wild type C. reinhardtii supernatant. On the right it's passing through a transformed C. reinhardtii producing mCherry.