Difference between revisions of "Part:BBa K2136016:Design"
(hid sequences) |
|||
| Line 10: | Line 10: | ||
mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1]. | mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1]. | ||
| − | This sequence was codon optimized to match Chlamydomonas reinhardtii codons. Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein | + | This sequence was codon optimized to match Chlamydomonas reinhardtii codons. Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation. |
| + | <!--- | ||
| + | So here are the changes that we made in the DNA sequence using the software GeneArt from Life Technologies: | ||
| + | |||
| + | |||
Before codon optimization: | Before codon optimization: | ||
| − | 5'- | + | 5'- atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaa |
| − | + | gcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa -3' | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
After codon optimization: | After codon optimization: | ||
5'- | 5'- | ||
| − | + | ATGGTGTCCAAGGGCGAGGAGGACAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCAGCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCATGTACGGCAGCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACCTGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTCCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCAGCAGCGAGCGCATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGCGCCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTGAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTGAACATCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCTGAGGGCCGCCACAGCACCGGCGGCATGGACGAGCTGTACAAGTAA -3 | |
| − | + | ---> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
===Source=== | ===Source=== | ||
Latest revision as of 01:31, 19 October 2016
Codon optimized mCherry for Chlamydomonas reinhardtii
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1].
This sequence was codon optimized to match Chlamydomonas reinhardtii codons. Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation.
Source
mCherry is one of several "second-generation" monomeric fluorescent proteins developed in Roger Tsien's laboratory at UCSD (cf., Nature Biotechnology 22, 1567 - 1572 (2004). PMID 15558047