Difference between revisions of "Part:BBa K1890024"

Latest revision as of 23:07, 19 October 2016

GFP with weak constitutive promoter, RBS and terminator

Indroduction

Green fluorescent protein (GFP) originates from the jellyfish Aequorea victoria. This part contains a series of mutations compared to the wildtype GFP resulting in enhanced maturation and emission [1]. It is expressed under control of the weak constitutive promoter BBa_J23113, strong RBS BBa_B0030 and terminators BBa_B0010 and BBa_B0012.

This part is based on the part BBa_E0840, with an additional promoter and belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths:

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
INCOMPATIBLE WITH RFC[12]
Illegal NheI site found at 7
Illegal NheI site found at 30
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI.rc site found at 700

Construction

This part is based on the part BBa_E0840, which already contains RBS, GFP gene and terminators. By means of PCR we added the strong constitutive promoter BBa_J23113. Two PCR reactions were performed with the following primers (Table 1).

Table 1: Primers used to add promoter to GFP BioBrick.

Primer name	Sequence
E0840_FW	ATTAAAGAGGAGAAATACTAGATGCGTAAAGG
J23113-E0840_FW	CGGCGAATTCGCGGCCGCTTCTAGAGCTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCATTAAAGAGGAGAAATACTAGATGCGTAAAGG
VR	ATTACCGCCTTTGAGTGAGC

To prevent annealing of the primer containing the promoter (J23113-E0840_FW) to the BioBrick prefix, a preliminary PCR was performed with a forward primer not containing the BioBrick prefix (E0840_FW) (Figure 1).

**Figure 1:** Construction of the biobrick K1890024 by means of two PCRs, using biobrick E0840 as a template.

Characterization

In order to validate the fluorescence of the gene product, the plasmid was expressed in E. coli BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm (Figure 2).

**Figure 2:** Fluorescence spectrum of *E. coli* BL21 expressing this part at the excitation wavelength of 488 nm.

As documented by Cormack et al. the emission peak is indeed at 511 nm.

In order to compare this part to the other members of its collection, the spectra were measured in the same plate reader and the results were normalized by dividing by the OD600 (Figure 3).

**Figure 3:** Fluorescence spectrum of *E. coli* BL21 expressing GFP under five different constitutive promoters, at the excitation wavelength of 488 nm.

The fluorescence intensity of each of the individual strains is as expected, as compared to the promoter strengths.

References

[1] Cormack, B. P., Valdivia, R. H., & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene, 173(1), 33-38.

@@ Line 4: / Line 4: @@
 <h2>Indroduction</h2>
-Green fluorescent protein (GFP) from the jellyfish <i>Aequorea victoria</i>. This mutant contains a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter <partinfo>BBa_J23113</partinfo>, strong RBS <partinfo>BBa_B0030</partinfo> and terminators <partinfo>BBa_B0010</partinfo> and <partinfo>BBa_B0012</partinfo>.
+Green fluorescent protein (GFP) originates from the jellyfish <i>Aequorea victoria</i>. This part contains a series of mutations compared to the wildtype GFP resulting in enhanced maturation and emission [1]. It is expressed under control of the weak constitutive promoter <partinfo>BBa_J23113</partinfo>, strong RBS <partinfo>BBa_B0030</partinfo> and terminators <partinfo>BBa_B0010</partinfo> and <partinfo>BBa_B0012</partinfo>.
 This part is based on the part <partinfo>BBa_E0840</partinfo>, with an additional promoter and belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths:
@@ Line 40: / Line 40: @@
 <center><img src="https://static.igem.org/mediawiki/2016/5/56/T--TU_Delft--BBa_K1890024_construction.png" width="60%">
 <figcaption>
-<b>Figure 1</b>: Construction of the biobrick K1890024 by means of two PCRs, using biobrick E0840 as a template.
+<b>Figure 1:</b> Construction of the biobrick K1890024 by means of two PCRs, using biobrick E0840 as a template.
 </figcaption></center>
 </figure>
 <h2>Characterization</h2>
-<p>In order to validate the fluorescence of the gene product, the plasmid was expressed in <i>E. coli</i> BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm. (Figure 2) </p>
+<p>In order to validate the fluorescence of the gene product, the plasmid was expressed in <i>E. coli</i> BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm (Figure 2). </p>
 <figure>
 <center><img src="https://static.igem.org/mediawiki/2016/5/5b/T--TU_Delft--Spectrum_BBa_K1890024.png">
 <figcaption>
-<b>Figure 2</b>: Fluorescence spectrum of <i>E. coli</i> BL21 expressing this part at the excitation wavelength of 488 nm.
+<b>Figure 2:</b> Fluorescence spectrum of <i>E. coli</i> BL21 expressing this part at the excitation wavelength of 488 nm.
 </figcaption></center>
 </figure>
@@ Line 61: / Line 61: @@
 <center><img src="https://static.igem.org/mediawiki/2016/e/e9/T--TU_Delft--Spectra_GFP.png">
 <figcaption>
-<b>Figure 3</b>: Fluorescence spectrum of <i>E. coli</i> BL21 expressing GFP under five different constitutive promoters, at the excitation wavelength of 488 nm.
+<b>Figure 3:</b> Fluorescence spectrum of <i>E. coli</i> BL21 expressing GFP under five different constitutive promoters, at the excitation wavelength of 488 nm.
 </figcaption></center>
 </figure>