Difference between revisions of "Part:BBa K1890021"

 
Line 3: Line 3:
 
<partinfo>BBa_K1890021 short</partinfo>
 
<partinfo>BBa_K1890021 short</partinfo>
  
−
Green fluorescent protein (GFP) from the jellyfish Aequorea victoria. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter BBa_J23100, strong RBS BBa_B0030 and terminators BBa_B0010 and BBa_B0012.
+
<h2>Indroduction</h2>
 +
Green fluorescent protein (GFP) from the jellyfish <i>Aequorea victoria</i>. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter <partinfo>BBa_J23108</partinfo>, strong RBS <partinfo>BBa_B0030</partinfo> and terminators <partinfo>BBa_B0010</partinfo> and <partinfo>BBa_B0012</partinfo>.
  
−
<!-- Add more about the biology of this part here
+
This part is based on the part <partinfo>BBa_E0840</partinfo>, with an additional promoter. This part belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths:
−
===Usage and Biology===
+
* <partinfo>BBa_K1890020</partinfo>
 +
* <partinfo>BBa_K1890021</partinfo>
 +
* <partinfo>BBa_K1890022</partinfo>
 +
* <partinfo>BBa_K1890023</partinfo>
 +
* <partinfo>BBa_K1890024</partinfo>
  
−
<!-- -->
+
<h2><span class='h3bb'>Sequence and Features</span></h2>
−
<span class='h3bb'>Sequence and Features</span>
+
 
<partinfo>BBa_K1890021 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1890021 SequenceAndFeatures</partinfo>
  
 +
<h2>Construction</h2>
 +
This part is based on the part <partinfo>BBa_E0840</partinfo>, which already contains RBS, GFP gene and terminators. By means of PCR we added the strong constitutive promoter <partinfo>BBa_J23108</partinfo>. Two PCR reactions were performed with the following primers (Table 1).
 +
 +
<b>Table 1:</b> Primers used to add promoter to GFP BioBrick.
 +
{| Border="1"
 +
! Primer name !! Sequence
 +
|-
 +
| E0840_FW || ATTAAAGAGGAGAAATACTAGATGCGTAAAGG
 +
|-
 +
| J23108-E0840_FW || CGGCGAATTCGCGGCCGCTTCTAGAGCTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCATTAAAGAGGAGAAATACTAGATGCGTAAAGG
 +
|-
 +
| VR || ATTACCGCCTTTGAGTGAGC
 +
 +
|-
 +
|-
 +
|}
 +
   
 +
To prevent annealing of the primer containing the promoter (J23108-E0840_FW) to the BioBrick prefix, a preliminary PCR was performed with a forward primer not containing the BioBrick prefix (E0840_FW) (Figure 1).
 +
 +
<html>
 +
   
 +
<figure>
 +
<center><img src="https://static.igem.org/mediawiki/2016/0/03/T--TU_Delft--BBa_K1890021_construction.png" width="60%">
 +
<figcaption>
 +
<b>Figure 1</b>: Construction of the biobrick K1890021 by means of two PCRs, using biobrick E0840 as a template.
 +
</figcaption></center>
 +
</figure>
 +
 +
<h2>Characterization</h2>
 +
<p>In order to validate the fluorescence of the gene product, the plasmid was expressed in <i>E. coli</i> BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm. (Figure 2) </p>
 +
 +
<figure>
 +
<center><img src="https://static.igem.org/mediawiki/2016/7/77/T--TU_Delft--Spectrum_BBa_K1890021.png">
 +
<figcaption>
 +
<b>Figure 2</b>: Fluorescence spectrum of <i>E. coli</i> BL21 expressing this part at the excitation wavelength of 488 nm.
 +
</figcaption></center>
 +
</figure>
 +
 +
<p>As documented by Cormack <i>et al.</i> the emission peak is indeed at 511 nm.</p>
 +
 +
<p>In order to compare this part to the other members of its collection, the spectra were measured in the same plate reader and the results were normalized by dividing by the OD600 (Figure 3).</p>
 +
 +
<figure>
 +
<center><img src="https://static.igem.org/mediawiki/2016/e/e9/T--TU_Delft--Spectra_GFP.png">
 +
<figcaption>
 +
<b>Figure 3</b>: Fluorescence spectrum of <i>E. coli</i> BL21 expressing GFP under five different constitutive promoters, at the excitation wavelength of 488 nm.
 +
</figcaption></center>
 +
</figure>
 +
 +
<p>The fluorescence intensity of each of the individual strains is as expected, as compared to the promoter strengths. </p>
 +
 +
</html>
 +
 +
<h2>References</h2>
 +
[1] Cormack, B. P., Valdivia, R. H., & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene, 173(1), 33-38.
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Revision as of 19:43, 16 October 2016


GFP with strong constitutive promoter, RBS and terminator

Indroduction

Green fluorescent protein (GFP) from the jellyfish Aequorea victoria. This mutant represents a series of mutations resulting in enhanced maturation and emission [1]. It is expressed under control of the strong constitutive promoter BBa_J23108, strong RBS BBa_B0030 and terminators BBa_B0010 and BBa_B0012.

This part is based on the part BBa_E0840, with an additional promoter. This part belongs to the following part collection, consisting of GFP under five consitutive promoters with different strengths:

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 700

Construction

This part is based on the part BBa_E0840, which already contains RBS, GFP gene and terminators. By means of PCR we added the strong constitutive promoter BBa_J23108. Two PCR reactions were performed with the following primers (Table 1).

Table 1: Primers used to add promoter to GFP BioBrick.

Primer name Sequence
E0840_FW ATTAAAGAGGAGAAATACTAGATGCGTAAAGG
J23108-E0840_FW CGGCGAATTCGCGGCCGCTTCTAGAGCTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCATTAAAGAGGAGAAATACTAGATGCGTAAAGG
VR ATTACCGCCTTTGAGTGAGC

To prevent annealing of the primer containing the promoter (J23108-E0840_FW) to the BioBrick prefix, a preliminary PCR was performed with a forward primer not containing the BioBrick prefix (E0840_FW) (Figure 1).

Figure 1: Construction of the biobrick K1890021 by means of two PCRs, using biobrick E0840 as a template.

Characterization

In order to validate the fluorescence of the gene product, the plasmid was expressed in E. coli BL21, which was grown in eM9 medium. A fluorescence spectrum was measured in a plate reader at the excitation wavelength of 488 nm. (Figure 2)

Figure 2: Fluorescence spectrum of E. coli BL21 expressing this part at the excitation wavelength of 488 nm.

As documented by Cormack et al. the emission peak is indeed at 511 nm.

In order to compare this part to the other members of its collection, the spectra were measured in the same plate reader and the results were normalized by dividing by the OD600 (Figure 3).

Figure 3: Fluorescence spectrum of E. coli BL21 expressing GFP under five different constitutive promoters, at the excitation wavelength of 488 nm.

The fluorescence intensity of each of the individual strains is as expected, as compared to the promoter strengths.

References

[1] Cormack, B. P., Valdivia, R. H., & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene, 173(1), 33-38.