Difference between revisions of "Part:BBa K1926001"
Line 4: Line 4:
  
  
−
1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.
+
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K1926001 SequenceAndFeatures</partinfo>
  
−
2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.
 
  
  
−
===You may use this part to:===
+
===Usage===
 +
 
 +
You may use this part to:
  
 
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
 
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
Line 16: Line 19:
  
  
−
===Source:===
+
===Source===
  
 
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
 
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
Line 34: Line 37:
 
<br style="clear: both" />
 
<br style="clear: both" />
  
−
<!-- Add more about the biology of this part here
+
===Reference===
−
===Usage and Biology===
+
  
−
<!-- -->
+
1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.
−
<span class='h3bb'>Sequence and Features</span>
+
 
−
<partinfo>BBa_K1926001 SequenceAndFeatures</partinfo>
+
2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.
  
  

Revision as of 08:45, 11 October 2016

A cyclic promoter of Cyclin E from human genome

This part is a cyclic promoter of protein Cyclin E from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[1,2]


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NotI site found at 382
    Illegal NotI site found at 497
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 529
    Illegal XhoI site found at 1050
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 273
    Illegal NgoMIV site found at 313
    Illegal NgoMIV site found at 491
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;

2) Use it as a human promoter by transient transfecting it into cells.


Source

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:

pCCNE-F: CGTGTTTACATTCCACCCGCGCCA

pCCNE-R: TGATGGGGCTGCTCCGGCCT

(Product: 986)


Promoter function confirmation

G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.

Figure 1: in vivo testing pG1 promoter function in human 293 cell line.


Reference

1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.

2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.