Difference between revisions of "Part:BBa K1679004"
Line 4: | Line 4: | ||
BBa_J23101 is a strong promoter which is well characterized by many teams who take part in 2015 InterLab Study. RiboJ is a Ribozyme-based insulator part that can buffer synthetic circuits. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme with an additional 23-nt hairpin immediately downstream to help expose the RBS. This part can be used as a promoter-like part. | BBa_J23101 is a strong promoter which is well characterized by many teams who take part in 2015 InterLab Study. RiboJ is a Ribozyme-based insulator part that can buffer synthetic circuits. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme with an additional 23-nt hairpin immediately downstream to help expose the RBS. This part can be used as a promoter-like part. | ||
− | Attention Please! | + | <h3>Attention Please!</h3> |
The right sequence should be "tttacagctagctcagtcctaggtattatgctagctactagagagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa". | The right sequence should be "tttacagctagctcagtcctaggtattatgctagctactagagagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa". | ||
But the DNA Sample we submit is correct. | But the DNA Sample we submit is correct. |
Latest revision as of 10:35, 10 October 2016
J23101 and RiboJ
BBa_J23101 is a strong promoter which is well characterized by many teams who take part in 2015 InterLab Study. RiboJ is a Ribozyme-based insulator part that can buffer synthetic circuits. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme with an additional 23-nt hairpin immediately downstream to help expose the RBS. This part can be used as a promoter-like part.
Attention Please!
The right sequence should be "tttacagctagctcagtcctaggtattatgctagctactagagagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa". But the DNA Sample we submit is correct. We are so sorry for this problem.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]