Difference between revisions of "Part:BBa K2009357"
Line 1: | Line 1: | ||
+ | |||
+ | |||
+ | <partinfo>BBa_K2009357 short</partinfo> | ||
+ | |||
+ | <p style="font-weight:bold; font-size:20px;">Sequence And Features</p> | ||
+ | <partinfo>BBa_K2009357 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | <p style="font-weight:bold; font-size:20px;">introduction</p> | ||
+ | <hr> | ||
+ | <p > </p> | ||
+ | |||
+ | |||
+ | Sup35——PSB1C3 length: 759bp | ||
+ | <br> | ||
+ | Derived from: PCR from the plasmid provided from Dong Men | ||
+ | |||
+ | Sup35p is a subunit of the translation termination complex. In nature, it has been proved to have kinds of prionic effect on the stress response, When the conformation is transformed into prionic form, the termination of translation is less effective and thus new longer proteins form (True and Lindquist, 2000; Tyedmers et al., 2008). Research found that if the sequence corresponding to the NM domains of Sup35p is fused to other gene, the protein resulting of this construction acquires the prionic behaviour (Li and Lindquist, 2000). | ||
+ | Tyedmers et al. (2000) found that heat shock is a significantly relevant factor to trigger the prionic conformation. Heat shock will induce The cells the prionic phenotype, it is an autocatalytic process and finally, all the protein is found in the prionic conformation. The cells resulting show the phenotype [PSI+]. One of the most possible reason for phenomenon is that HSP104 play an important role in the formation and maintenance of the amyloid fiber (Halfmann et al., 2009). | ||
+ | The SUP35NM gene we used is provided by Dong Men, PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences, so that the sequence is not quite the same as the existing sequence in the Parts Registry, for a lot of mutations have been done. The standardization of this gene is did by ourselves by adding the Biobrick prefix and suffix to its ends and doing a site mutation to eliminate the PstI cutting site inside it. | ||
+ | |||
+ | <p style="font-weight:bold; font-size:20px;">Part Sequence</p> | ||
+ | <hr> | ||
+ | |||
+ | <div style="max-width:100%; overflow:scroll;"> | ||
+ | atgtcggattcaaaccagggcaacaaccagcaaaattaccagcagtattcccaaaacggcaaccagcaacaaggtaacaatcgctatcaggggtaccaggcgtacaatgcccaagcacaaccggcaggcggctattatcagaactaccagggctacagcggttaccaacagggtggttatcagcagtataaccccgatgctgggtatcagcagcagtataatccccaaggcgggtatcagcagtacaacccacagggtggctatcagcaacagtttaatccgcagggcggacgcggtaactacaaaaacttcaactataacaataatttacaggggtaccaagctggttttcagcctcagagtcaggggatgtctctgaatgatttccaaaaacagcaaaagcaagcagctccaaaaccgaaaaaaaccctgaaattagtgtccagctcgggaattaaactcgctaacgccacgaagaaggtgggcacgaaaccggctgaaagcgataaaaaagaggaagagaagagcgcggaaaccaaggaaccgaccaaagagccgactaaagtcgaagaacctgtgaaaaaagaagagaaacctgtacagacggaagagaaaactgaggagaaatcggaattacccaaagtcgaggatttgaaaatttcggaaagcacccataacacaaacaatgcgaatgttacatccgcggatgcgttgattaaagaacaggaagaggaagttgacgatgaggtggtgaatgat</div> | ||
+ | (All the sequence has been testified by Sangon) | ||
+ | |||
+ | <!-- Add more about the biology of this part here | ||
+ | ===Usage and Biology=== | ||
+ | |||
+ | <!-- --> | ||
+ | |||
+ | |||
+ | <!-- Uncomment this to enable Functional Parameter display | ||
+ | ===Functional Parameters=== | ||
+ | <partinfo>BBa_K2009357 parameters</partinfo> | ||
+ | <!-- --> |
Latest revision as of 09:10, 15 September 2016
SUP35
Sequence And Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 522
introduction
Sup35——PSB1C3 length: 759bp
Derived from: PCR from the plasmid provided from Dong Men
Sup35p is a subunit of the translation termination complex. In nature, it has been proved to have kinds of prionic effect on the stress response, When the conformation is transformed into prionic form, the termination of translation is less effective and thus new longer proteins form (True and Lindquist, 2000; Tyedmers et al., 2008). Research found that if the sequence corresponding to the NM domains of Sup35p is fused to other gene, the protein resulting of this construction acquires the prionic behaviour (Li and Lindquist, 2000). Tyedmers et al. (2000) found that heat shock is a significantly relevant factor to trigger the prionic conformation. Heat shock will induce The cells the prionic phenotype, it is an autocatalytic process and finally, all the protein is found in the prionic conformation. The cells resulting show the phenotype [PSI+]. One of the most possible reason for phenomenon is that HSP104 play an important role in the formation and maintenance of the amyloid fiber (Halfmann et al., 2009). The SUP35NM gene we used is provided by Dong Men, PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences, so that the sequence is not quite the same as the existing sequence in the Parts Registry, for a lot of mutations have been done. The standardization of this gene is did by ourselves by adding the Biobrick prefix and suffix to its ends and doing a site mutation to eliminate the PstI cutting site inside it.
Part Sequence
(All the sequence has been testified by Sangon)