Difference between revisions of "Part:BBa K1679006"

(Overview)
 
Line 8: Line 8:
 
<p>Promoter parts are often defined by a relatively short (~50 bp) sequence, but regions 100 bp or more upstream can affect promoter strength, and the effect of remote sequences can be reduced by including an insulator region.Ribo J is a kind of ribozyme-based insulator part that can buffer synthetic circuits from genetic context. It is a useful tool for measuring the strength of promoters which can make the disruption from genetic context to be reduced.
 
<p>Promoter parts are often defined by a relatively short (~50 bp) sequence, but regions 100 bp or more upstream can affect promoter strength, and the effect of remote sequences can be reduced by including an insulator region.Ribo J is a kind of ribozyme-based insulator part that can buffer synthetic circuits from genetic context. It is a useful tool for measuring the strength of promoters which can make the disruption from genetic context to be reduced.
 
As a matter of fact, our results from plate reader and flow cytometer show that the expression of GFP under J23117 promoter have a little difference with or without Ribo J. It proved that the Ribo J did has the function of buffering.</P>
 
As a matter of fact, our results from plate reader and flow cytometer show that the expression of GFP under J23117 promoter have a little difference with or without Ribo J. It proved that the Ribo J did has the function of buffering.</P>
 
+
<h3>Attention Please!</h3>
 +
The right sequence should be "agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata".
 +
But the DNA Sample we submit is correct.
 +
We are so sorry for this problem.
 
===Plate Reader Result===
 
===Plate Reader Result===
  

Latest revision as of 10:42, 10 October 2016

RiboJ and GFP

This part is a composite of RiboJ and I13504 which can be used to express GFP if added a promoter.

Overview

This part can be added a promoter to meet a variety of requirements.

Promoter parts are often defined by a relatively short (~50 bp) sequence, but regions 100 bp or more upstream can affect promoter strength, and the effect of remote sequences can be reduced by including an insulator region.Ribo J is a kind of ribozyme-based insulator part that can buffer synthetic circuits from genetic context. It is a useful tool for measuring the strength of promoters which can make the disruption from genetic context to be reduced. As a matter of fact, our results from plate reader and flow cytometer show that the expression of GFP under J23117 promoter have a little difference with or without Ribo J. It proved that the Ribo J did has the function of buffering.

Attention Please!

The right sequence should be "agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata". But the DNA Sample we submit is correct. We are so sorry for this problem.

Plate Reader Result

Equipment

Varioskan Flash Multimode Reader
Thermo Scientific
Read Speed: 6.4 well per second

Software

Run Software Version: Skanlt Software 2.4.5 RE for Varioskan Flash
Current Software Version: Skanlt Software 2.4.5 RE for Varioskan Flash

Protocol

Date: 2015 Aug 12
1. Set our instrument to read OD600
2. Setup a 96-well plate with our cultures
3. Take the measurement and record it
4. Calculate the dilution required for each sample (OD600=0.5)
5. Dilute each sample
6. Remeasure our sample on OD600
7. Recalculate our dilution and remeasure until it's within 5% of 0.5.

Unit

Three technical replicates of M9 liquid media was measured, which were called background value.
A series of concentration of sodium fluorescein was measured, which are 0, 10, 20, 40, 80, 160, 320, 640 ng/mL . A calibration curve was defined.

OUC-China-InterLab_2.jpg

Dataset

All samples were cut the mean of background value, and then compared with the calibration curve to get the final dataset in units of fluorescein.

OUC-China-InterLab_4.jpg

TR: Technical Replicate
BR: Biological Replicate

OUC-China-InterLab_5.png


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 745