Difference between revisions of "Part:BBa K1728019"

Latest revision as of 19:25, 29 October 2017

SAT toehold switch RNA sensor with T7 promoter & luciferase reporter

SAT toehold switch RNA sensor with T7 promoter & luciferase reporter

Usage and Biology

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(GCACCTAACCGTTCAATAACATAGAACTCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Signal Transducer and Activator of Transcription (SAT) mRNA(SAT partial sequence, BBa_K1728007). Once the SAT mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(SAT toehold switch RNA sensor, BBa_K1728003). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.

In Vivo Assay

We lysed the bacteria to get the lysate. There are two groups, one is toehold switch only; the other is toehold switch treated with trigger, which is made by cotransformation of the two constructed plasmids: BBa_K1728019 and BBa_K1728011. The two plasmids can be selected for that they were constructed with different backbones which contains different antibiotics resistance. Thus, the bacteria can survive the environment with ampicillin and chloramphenicol antibiotics added if the two plasmids are successfully cotransformed.

Reference

Improved part: https://parts.igem.org/Part:BBa_K2254999

Sequence and Features