Difference between revisions of "Part:BBa K1728008"
Line 5: | Line 5: | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
− | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch. | + | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence. |
<!-- --> | <!-- --> |
Revision as of 21:58, 18 September 2015
IL8 toehold switch RNA sensor with T7 promoter
IL8 toehold switch RNA sensor with T7 promoter
Usage and Biology
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]