Difference between revisions of "Part:BBa K1795002"
Adhalleran (Talk | contribs) |
|||
| Line 4: | Line 4: | ||
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed. | This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed. | ||
| + | When co-transformed with RFP and BBa_K1795001 97% reduction of RFP was observed. | ||
| + | [https://static.igem.org/mediawiki/2015/1/1b/WMgRNACompare.png] | ||
Latest revision as of 19:53, 18 September 2015
R0010 gRNA under R0040
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.
When co-transformed with RFP and BBa_K1795001 97% reduction of RFP was observed. [1]
![[1]](https://static.igem.org/mediawiki/2015/1/1b/WMgRNACompare.png){kind=link}
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]