Difference between revisions of "Part:BBa K1728018"

 
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1728018 short</partinfo>
 
<partinfo>BBa_K1728018 short</partinfo>
Line 5: Line 4:
 
DUSP1 toehold switch RNA sensor with T7 promoter & luciferase reporter
 
DUSP1 toehold switch RNA sensor with T7 promoter & luciferase reporter
  
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(AAATAAATTGAAGTGGGCTCAAGGAGACCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Dual specificity protein phosphatase 1 (DUSP1) mRNA(DUSP1 partial sequence, BBa_K1728006). Once the DUSP1 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(DUSP1 toehold switch RNA sensor, BBa_K1728002).This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.
  
 
<!-- -->
 
<!-- -->

Revision as of 23:08, 18 September 2015

DUSP1 toehold switch RNA sensor with T7 promoter & luciferase reporter

DUSP1 toehold switch RNA sensor with T7 promoter & luciferase reporter

Usage and Biology

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(AAATAAATTGAAGTGGGCTCAAGGAGACCC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Dual specificity protein phosphatase 1 (DUSP1) mRNA(DUSP1 partial sequence, BBa_K1728006). Once the DUSP1 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(DUSP1 toehold switch RNA sensor, BBa_K1728002).This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 47
    Illegal SapI.rc site found at 922