Difference between revisions of "Part:BBa K1728017"
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1728017 short</partinfo> | <partinfo>BBa_K1728017 short</partinfo> | ||
Line 5: | Line 4: | ||
IL1β toehold switch RNA sensor with T7 promoter & luciferase reporter | IL1β toehold switch RNA sensor with T7 promoter & luciferase reporter | ||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TTTCCCTTCATCTTTGAAGAAGAACCTATC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 1β (IL-1β) mRNA(IL1β partial sequence, BBa_K1728005). Once the IL-1β mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(IL1β toehold switch RNA sensor, BBa_K1728001). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter. | ||
<!-- --> | <!-- --> |
Latest revision as of 23:06, 18 September 2015
IL1β toehold switch RNA sensor with T7 promoter & luciferase reporter
IL1β toehold switch RNA sensor with T7 promoter & luciferase reporter
Usage and Biology
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TTTCCCTTCATCTTTGAAGAAGAACCTATC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 1β (IL-1β) mRNA(IL1β partial sequence, BBa_K1728005). Once the IL-1β mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(IL1β toehold switch RNA sensor, BBa_K1728001). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 922