Difference between revisions of "Part:BBa K1728017"

 
 
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1728017 short</partinfo>
 
<partinfo>BBa_K1728017 short</partinfo>
Line 5: Line 4:
 
IL1&#946; toehold switch RNA sensor with T7 promoter & luciferase reporter
 
IL1&#946; toehold switch RNA sensor with T7 promoter & luciferase reporter
  
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TTTCCCTTCATCTTTGAAGAAGAACCTATC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 1β (IL-1β) mRNA(IL1β partial sequence, BBa_K1728005). Once the IL-1β mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(IL1β toehold switch RNA sensor, BBa_K1728001).  This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.
  
 
<!-- -->
 
<!-- -->

Latest revision as of 23:06, 18 September 2015

IL1β toehold switch RNA sensor with T7 promoter & luciferase reporter

IL1β toehold switch RNA sensor with T7 promoter & luciferase reporter

Usage and Biology

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TTTCCCTTCATCTTTGAAGAAGAACCTATC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 1β (IL-1β) mRNA(IL1β partial sequence, BBa_K1728005). Once the IL-1β mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(IL1β toehold switch RNA sensor, BBa_K1728001). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 922